Morpholino

MO2-cenpw

ID
ZDB-MRPHLNO-111025-2
Name
MO2-cenpw
Previous Names
None
Target
Sequence
5' - GAACCTTCTTCAACTCACCATCAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cenpw
No data available
Phenotype
Phenotype resulting from MO2-cenpw
Phenotype Fish Figures
anterior commissure axon organization quality, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
apoptotic process increased occurrence, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
chromosome segregation disrupted, abnormal WT + MO2-cenpw Fig. 5 with image from Kim et al., 2011
extension decreased thickness, abnormal WT + MO11-tp53 + MO2-cenpw Fig. 3 with image from Kim et al., 2011
eye decreased size, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
head flattened, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
medial longitudinal fasciculus neuron decreased amount, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
midbrain hindbrain boundary decreased thickness, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
mitotic cell cycle disrupted, abnormal WT + MO2-cenpw Fig. 5 with image from Kim et al., 2011
neural plate mitotic spindle decreased functionality, abnormal WT + MO2-cenpw Fig. 5 with image from Kim et al., 2011
neural tube decreased size, abnormal WT + MO2-cenpw Fig. 4 with image from Kim et al., 2011
neural tube cell decreased amount, abnormal WT + MO2-cenpw Fig. 4 with image from Kim et al., 2011
retina layer formation disrupted, abnormal WT + MO2-cenpw Fig. 4 with image from Kim et al., 2011
rhombomere neuron decreased amount, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
Rohon-Beard neuron decreased branchiness, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
trunk curved, abnormal WT + MO11-tp53 + MO2-cenpw Fig. 3 with image from Kim et al., 2011
Phenotype of all Fish created by or utilizing MO2-cenpw
Phenotype Fish Conditions Figures
retina layer formation disrupted, abnormal WT + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
midbrain hindbrain boundary decreased thickness, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
apoptotic process increased occurrence, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
head flattened, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
eye decreased size, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
neural plate mitotic spindle decreased functionality, abnormal WT + MO2-cenpw standard conditions Fig. 5 with image from Kim et al., 2011
mitotic cell cycle disrupted, abnormal WT + MO2-cenpw standard conditions Fig. 5 with image from Kim et al., 2011
neural tube decreased size, abnormal WT + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
extension decreased thickness, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
chromosome segregation disrupted, abnormal WT + MO2-cenpw standard conditions Fig. 5 with image from Kim et al., 2011
neural tube cell decreased amount, abnormal WT + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
trunk curved, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
eye decreased size, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
trunk curved, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
midbrain hindbrain boundary decreased thickness, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
head flattened, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
extension decreased thickness, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
anterior commissure axon organization quality, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
rhombomere neuron decreased amount, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
medial longitudinal fasciculus neuron decreased amount, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
Rohon-Beard neuron decreased branchiness, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.