Morpholino

MO3-crfb1

ID
ZDB-MRPHLNO-111024-1
Name
MO3-crfb1
Previous Names
None
Target
Sequence
5' - CGCCAAGATCATACCTGTAAAGTAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO. The corrected sequence was provided by the author.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-crfb1
No data available
Phenotype
Phenotype resulting from MO3-crfb1
No data available
Phenotype of all Fish created by or utilizing MO3-crfb1
Citations