Morpholino

MO3-tgfb3

ID

ZDB-MRPHLNO-110929-8

Name

MO3-tgfb3

Previous Names

Target

Sequence

5' - GCATGGTTAATATCTGCACACTATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-tgfb3

No data available

Phenotype

Phenotype resulting from MO3-tgfb3

Phenotype	Fish	Figures
basihyal cartilage aplastic, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
cranial cartilage hypoplastic, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
head decreased size, abnormal	SING + MO3-tgfb3	Fig. 1 from Cheah et al., 2010
heart decreased size, abnormal	SING + MO3-tgfb3	Fig. 1 from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
mouth ventrally rotated head, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
neurocranium decreased size, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
palatoquadrate cartilage hypoplastic, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
pericardium increased size, abnormal	SING + MO3-tgfb3	Fig. 1 from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal	SING + MO3-tgfb3	Fig. S1 from Cheah et al., 2010
ventral mandibular arch malformed, abnormal	SING + MO3-tgfb3	Fig. 1 from Cheah et al., 2010

Phenotype of all Fish created by or utilizing MO3-tgfb3

Phenotype	Fish	Conditions	Figures
cranial cartilage hypoplastic, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
heart decreased size, abnormal	SING + MO3-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
pericardium increased size, abnormal	SING + MO3-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
neurocranium decreased size, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
ventral mandibular arch malformed, abnormal	SING + MO3-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
palatoquadrate cartilage hypoplastic, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
basihyal cartilage aplastic, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
mouth ventrally rotated head, abnormal	SING + MO3-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
head decreased size, abnormal	SING + MO3-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010

Citations