Morpholino
MO1-kcnq1.1
- ID
- ZDB-MRPHLNO-110928-16
- Name
- MO1-kcnq1.1
- Previous Names
-
- MO1-kcnq1
- Target
- Sequence
-
5' - TTGAGGAGAGACTTTCACGCCTGAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kcnq1.1
No data available
Phenotype
Phenotype resulting from MO1-kcnq1.1
from 1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-kcnq1.1
1 - 2 of 2
Citations
- Geng, F.S., Abbas, L., Baxendale, S., Holdsworth, C.J., Swanson, A.G., Slanchev, K., Hammerschmidt, M., Topczewski, J., and Whitfield, T.T. (2013) Semicircular canal morphogenesis in the zebrafish inner ear requires the function of gpr126 (lauscher), an adhesion class G protein-coupled receptor gene. Development (Cambridge, England). 40(21):4362-4374
- Liu, C.T., Garnaas, M.K., Tin, A., Kottgen, A., Franceschini, N., Peralta, C.A., de Boer, I.H., Lu, X., Atkinson, E., Ding, J., Nalls, M., Shriner, D., Coresh, J., Kutlar, A., Bibbins-Domingo, K., Siscovick, D., Akylbekova, E., Wyatt, S., Astor, B., Mychaleckjy, J., Li, M., Reilly, M.P., Townsend, R.R., Adeyemo, A., Zonderman, A.B., de Andrade, M., Turner, S.T., Mosley, T.H., Harris, T.B., Rotimi, C.N., Liu, Y., Kardia, S.L., Evans, M.K., Shlipak, M.G., Kramer, H., Flessner, M.F., Dreisbach, A.W., Goessling, W., Cupples, L.A., Kao, W.L., Fox, C.S. (2011) Genetic Association for Renal Traits among Participants of African Ancestry Reveals New Loci for Renal Function. PLoS Genetics. 7(9):e1002264
1 - 2 of 2
Show