Morpholino

MO2-pard6gb

ID

ZDB-MRPHLNO-110908-4

Name

MO2-pard6gb

Previous Names

pard6 Ex2 (1)

Target

pard6gb (1)

Sequence

5' - GAAGCGAGTGAGCTCGTACCTTGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-pard6gb

No data available

Phenotype

Phenotype resulting from MO2-pard6gb

Phenotype	Fish	Figures
cloaca development disrupted, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	Fig. 8 from Slanchev et al., 2011
epithelial cell migration involved in distal tubule morphogenesis disrupted, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	Fig. 8 from Slanchev et al., 2011
notochord undulate, abnormal	WT + MO2-pard6gb + MO4-tp53	Fig. 7 from Slanchev et al., 2011
pericardium edematous, abnormal	WT + MO2-pard6gb + MO4-tp53	Fig. 7 from Slanchev et al., 2011
pronephric duct decreased length, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	Fig. 8 from Slanchev et al., 2011
pronephric duct dilated, abnormal	WT + MO2-pard6gb + MO4-tp53	Fig. 7 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal	WT + MO2-pard6gb + MO4-tp53	Fig. 7 from Slanchev et al., 2011
pronephros cystic, abnormal	WT + MO2-pard6gb + MO4-tp53	Fig. 7 from Slanchev et al., 2011
whole organism curved, abnormal	WT + MO2-pard6gb + MO4-tp53	Fig. 7 from Slanchev et al., 2011

Phenotype of all Fish created by or utilizing MO2-pard6gb

Phenotype	Fish	Conditions	Figures
pronephric duct cilium disoriented, abnormal	WT + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 7 from Slanchev et al., 2011
whole organism curved, abnormal	WT + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 7 from Slanchev et al., 2011
pronephric duct dilated, abnormal	WT + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 7 from Slanchev et al., 2011
pericardium edematous, abnormal	WT + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 7 from Slanchev et al., 2011
notochord undulate, abnormal	WT + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 7 from Slanchev et al., 2011
pronephros cystic, abnormal	WT + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 7 from Slanchev et al., 2011
cloaca development disrupted, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
pronephric duct decreased length, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
epithelial cell migration involved in distal tubule morphogenesis disrupted, abnormal	zf106Tg + MO2-pard6gb + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
pronephric duct decreased length, abnormal	zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
epithelial cell migration involved in distal tubule morphogenesis disrupted, abnormal	zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
cloaca development disrupted, abnormal	zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal	zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal	zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53	standard conditions	Fig. 8 from Slanchev et al., 2011

Citations