Morpholino

MO2-pard6gb

ID
ZDB-MRPHLNO-110908-4
Name
MO2-pard6gb
Previous Names
  • pard6 Ex2 (1)
Target
Sequence
5' - GAAGCGAGTGAGCTCGTACCTTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 19
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pard6gb
No data available
Phenotype
Phenotype resulting from MO2-pard6gb
Phenotype of all Fish created by or utilizing MO2-pard6gb
Phenotype Fish Conditions Figures
pronephric duct cilium disoriented, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
whole organism curved, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
pericardium edematous, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
notochord undulate, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO2-pard6gb + MO4-tp53 standard conditions Fig. 7 from Slanchev et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
epithelial cell migration involved in distal tubule morphogenesis disrupted, abnormal zf106Tg + MO2-pard6gb + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
epithelial cell migration involved in distal tubule morphogenesis disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
Citations