Morpholino
MO3-nphp4
- ID
- ZDB-MRPHLNO-110908-2
- Name
- MO3-nphp4
- Previous Names
-
- nphp4 Ex1 (1)
- Target
- Sequence
-
5' - ATTTATTCCCCATCCACCTGTGTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nphp4
No data available
Phenotype
Phenotype resulting from MO3-nphp4
1 - 5 of 22 Show all
Phenotype of all Fish created by or utilizing MO3-nphp4
1 - 5 of 40 Show all
Citations
- Wang, H., Zaiser, F., Eckert, P., Ruf, J., Kayser, N., Veenstra, A.C., Müller, M., Haas, R., Walz, G., Yakulov, T.A. (2023) Inversin (NPHP2) and Vangl2 are required for normal zebrafish cloaca formation. Biochemical and Biophysical Research Communications. 673:9159-15
- Kayser, N., Zaiser, F., Veenstra, A.C., Wang, H., Göcmen, B., Eckert, P., Franz, H., Köttgen, A., Walz, G., Yakulov, T.A. (2022) Clock genes rescue nphp mutations in zebrafish. Human molecular genetics. 31(24):4143-4158
- Slanchev, K., Pütz, M., Schmitt, A., Kramer-Zucker, A., and Walz, G. (2011) Nephrocystin-4 is required for pronephric duct-dependent cloaca formation in zebrafish. Human molecular genetics. 20(16):3119-28
1 - 3 of 3
Show