Morpholino
MO1-nphp4
- ID
- ZDB-MRPHLNO-110808-1
- Name
- MO1-nphp4
- Previous Names
-
- N4ATG-Mo (1)
- Target
- Sequence
-
5' - GCGCTTCTCCACTCAGACATCAGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphp4
Expressed Gene | Anatomy | Figures |
---|---|---|
spaw |
Fig. S2
from Burcklé et al., 2011 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-nphp4
1 - 5 of 29 Show all
Phenotype of all Fish created by or utilizing MO1-nphp4
1 - 5 of 60 Show all
Citations
- Wang, H., Zaiser, F., Eckert, P., Ruf, J., Kayser, N., Veenstra, A.C., Müller, M., Haas, R., Walz, G., Yakulov, T.A. (2023) Inversin (NPHP2) and Vangl2 are required for normal zebrafish cloaca formation. Biochemical and Biophysical Research Communications. 673:9159-15
- Epting, D., Decker, E., Ott, E., Eisenberger, T., Bader, I., Bachmann, N., Bergmann, C. (2022) The ciliary transition zone protein TMEM218 synergistically interacts with the NPHP module and its reduced dosage leads to a wide range of syndromic ciliopathies. Human molecular genetics. 31(14):2295-2306
- Garcia, H., Serafin, A.S., Silbermann, F., Porée, E., Viau, A., Mahaut, C., Billot, K., Birgy, É., Garfa-Traore, M., Roy, S., Ceccarelli, S., Mehraz, M., Rodriguez, P.C., Deleglise, B., Furio, L., Jabot-Hanin, F., Cagnard, N., Del Nery, E., Fila, M., Sin-Monnot, S., Antignac, C., Lyonnet, S., Krug, P., Salomon, R., Annereau, J.P., Benmerah, A., Delous, M., Briseño-Roa, L., Saunier, S. (2022) Agonists of prostaglandin E2 receptors as potential first in class treatment for nephronophthisis and related ciliopathies. Proceedings of the National Academy of Sciences of the United States of America. 119:e2115960119
- Kayser, N., Zaiser, F., Veenstra, A.C., Wang, H., Göcmen, B., Eckert, P., Franz, H., Köttgen, A., Walz, G., Yakulov, T.A. (2022) Clock genes rescue nphp mutations in zebrafish. Human molecular genetics. 31(24):4143-4158
- Borgal, L., Habbig, S., Hatzold, J., Liebau, M.C., Dafinger, C., Sacarea, I., Hammerschmidt, M., Benzing, T., and Schermer, B. (2012) The Ciliary Protein Nephrocystin-4 Translocates the Canonical Wnt-Regulator Jade-1 to the Nucleus to Negatively Regulate Beta-Catenin Signaling. The Journal of biological chemistry. 287(30):25370-25380
- Burcklé, C., Gaudé, H.M., Vesque, C., Silbermann, F., Salomon, R., Jeanpierre, C., Antignac, C., Saunier, S., and Schneider-Maunoury, S. (2011) Control of the Wnt pathways by nephrocystin-4 is required for morphogenesis of the zebrafish pronephros. Human molecular genetics. 20(13):2611-27
- Slanchev, K., Pütz, M., Schmitt, A., Kramer-Zucker, A., and Walz, G. (2011) Nephrocystin-4 is required for pronephric duct-dependent cloaca formation in zebrafish. Human molecular genetics. 20(16):3119-28
1 - 7 of 7
Show