header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110628-7
Morpholino Name: MO2-ttll6
Target: ttll6 (1)
Previous Name: ttll6ATGMo (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTGGTGTCCCCATTCTGATCTCTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ttll6 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ttll6 No data available
PHENOTYPE
Phenotype resulting from MO2-ttll6
Phenotype of all Fish created by or utilizing MO2-ttll6
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO2-ttll6 standard conditions Fig. 3Fig. 5 from Pathak et al., 2011
inner ear lacks parts or has fewer parts of type otolith, abnormal AB/TU + MO2-ttll6 standard conditions Fig. 3Fig. 5 from Pathak et al., 2011
tubulin-glutamic acid ligase activity disrupted, abnormal AB/TU + MO2-ttll6 standard conditions Fig. 3 from Pathak et al., 2011
cilium movement amplitude, abnormal AB/TU + MO2-ttll6 standard conditions Fig. 5 from Pathak et al., 2011
head hydrocephalic, abnormal AB/TU + MO2-ttll6 standard conditions Fig. 5 from Pathak et al., 2011
pronephros cystic, abnormal AB/TU + MO2-ttll6 standard conditions Fig. 3Fig. 5 from Pathak et al., 2011
heart edematous, abnormal WT + MO2-ttll6 standard conditions Fig. 4 from Lee et al., 2012
pronephros cystic, abnormal WT + MO2-ttll6 standard conditions Fig. 4 from Lee et al., 2012
pronephric duct axonemal microtubule increased amount, abnormal WT + MO2-ttll6 standard conditions Fig. 4Fig. S11 from Lee et al., 2012
pronephric duct axonemal microtubule decreased size, abnormal WT + MO2-ttll6 standard conditions Fig. 4Fig. S11 from Lee et al., 2012
pronephric duct axoneme morphology, abnormal WT + MO2-ttll6 standard conditions Fig. 4Fig. S11 from Lee et al., 2012
post-vent region morphology, abnormal WT + MO2-ttll6 standard conditions Fig. 4 from Lee et al., 2012
post-vent region curved, abnormal WT + MO2-ttll6 standard conditions Fig. 4 from Lee et al., 2012
inner ear altered number of otolith, abnormal WT + MO2-ttll6 standard conditions Fig. 4 from Lee et al., 2012
pronephros cystic, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 5 from Pathak et al., 2011
inner ear lacks parts or has fewer parts of type otolith, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 5 from Pathak et al., 2011
pronephros cilium uncoordinated, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 5 from Pathak et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 5 from Pathak et al., 2011
cilium movement amplitude, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 5 from Pathak et al., 2011
pronephros axoneme structure, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 6 from Pathak et al., 2011
cilium movement irregular rhythm, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 5 from Pathak et al., 2011
pronephros axonemal dynein complex decreased amount, abnormal AB/TU + MO2-ttll6 + MO3-ttll3 standard conditions Fig. 6 from Pathak et al., 2011
OTHER MO2-ttll6 MORPHOLINO PAGES No links to external sites
CITATIONS (2)