Morpholino

MO3-ttll3

ID

ZDB-MRPHLNO-110628-6

Name

MO3-ttll3

Previous Names

ttll3ex7dMo (1)

Target

ttll3 (1)

Sequence

5' - GATTAAGAGCACTGACCAATAAAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-ttll3

No data available

Phenotype

Phenotype resulting from MO3-ttll3

Phenotype	Fish	Figures
cilium movement amplitude, abnormal	AB/TU + MO3-ttll3	Fig. 5 from Pathak et al., 2011
pronephros cystic, abnormal	AB/TU + MO3-ttll3	Fig. 3, Fig. 5 from Pathak et al., 2011
pronephros cilium direction, abnormal	AB/TU + MO3-ttll3	Fig. 4 from Pathak et al., 2011
pronephros cilium inverted, abnormal	AB/TU + MO3-ttll3	Fig. 4 from Pathak et al., 2011
tubulin-glycine ligase activity arrested, abnormal	AB/TU + MO3-ttll3	Fig. 3 from Pathak et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal	AB/TU + MO3-ttll3	Fig. 3, Fig. 5 from Pathak et al., 2011

Phenotype of all Fish created by or utilizing MO3-ttll3

Phenotype	Fish	Conditions	Figures
pronephros cilium direction, abnormal	AB/TU + MO3-ttll3	standard conditions	Fig. 4 from Pathak et al., 2011
pronephros cilium inverted, abnormal	AB/TU + MO3-ttll3	standard conditions	Fig. 4 from Pathak et al., 2011
cilium movement amplitude, abnormal	AB/TU + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal	AB/TU + MO3-ttll3	standard conditions	Fig. 3, Fig. 5 from Pathak et al., 2011
pronephros cystic, abnormal	AB/TU + MO3-ttll3	standard conditions	Fig. 3, Fig. 5 from Pathak et al., 2011
tubulin-glycine ligase activity arrested, abnormal	AB/TU + MO3-ttll3	standard conditions	Fig. 3 from Pathak et al., 2011
pronephros cystic, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
inner ear lacks parts or has fewer parts of type otolith, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
pronephros cilium uncoordinated, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
cilium movement amplitude, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
pronephros axoneme structure, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 6 from Pathak et al., 2011
cilium movement irregular rhythm, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
pronephros axonemal dynein complex decreased amount, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 6 from Pathak et al., 2011

Citations