Morpholino
MO3-dre-mir-451a
- ID
- ZDB-MRPHLNO-110613-1
- Name
- MO3-dre-mir-451a
- Previous Names
-
- MO3-mir451
- MO3-mir451a
- Target
- Sequence
-
5' - CTAAACTCAGTAATGGTAACGGTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dre-mir-451a
No data available
Phenotype
Phenotype resulting from MO3-dre-mir-451a
No data available
Phenotype of all Fish created by or utilizing MO3-dre-mir-451a
1 - 2 of 2
Citations
- Yu, D., Dos Santos, C.O., Zhao, G., Jiang, J., Amigo, J.D., Khandros, E., Dore, L.C., Yao, Y., D'Souza, J., Zhang, Z., Ghaffari, S., Choi, J., Friend, S., Tong, W., Orange, J.S., Paw, B.H., and Weiss, M.J. (2010) miR-451 protects against erythroid oxidant stress by repressing 14-3-3ζ. Genes & Development. 24(15):1620-1633
- Dore, L.C., Amigo, J.D., Dos Santos, C.O., Zhang, Z., Gai, X., Tobias, J.W., Yu, D., Klein, A.M., Dorman, C., Wu, W., Hardison, R.C., Paw, B.H., and Weiss, M.J. (2008) A GATA-1-regulated microRNA locus essential for erythropoiesis. Proceedings of the National Academy of Sciences of the United States of America. 105(9):3333-3338
1 - 2 of 2
Show