Morpholino

MO2-igfbp7

ID
ZDB-MRPHLNO-110610-2
Name
MO2-igfbp7
Previous Names
  • AGM-SPL-MO (1)
Target
Sequence
5' - CATCCAGAGCTGCTCACCCTGCGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-igfbp7
No data available
Phenotype
Phenotype resulting from MO2-igfbp7
Phenotype Fish Figures
blood cell decreased amount, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
blood circulation decreased occurrence, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
brain morphology, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO2-igfbp7 Fig. 5 from Hooper et al., 2009
extension morphology, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
heart contraction disrupted, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
hemopoiesis disrupted, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO2-igfbp7 Fig. 5 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO2-igfbp7 Fig. 5 from Hooper et al., 2009
melanocyte absent, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
pericardium edematous, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
pigmentation delayed, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
whole organism anterior-posterior axis decreased length, abnormal AB/TU + MO2-igfbp7 text only from Hooper et al., 2009
Phenotype of all Fish created by or utilizing MO2-igfbp7
Phenotype Fish Conditions Figures
extension morphology, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
blood circulation decreased occurrence, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
hemopoiesis disrupted, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
blood cell decreased amount, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
melanocyte absent, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
pericardium edematous, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
whole organism anterior-posterior axis decreased length, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
brain morphology, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
pigmentation delayed, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
heart contraction disrupted, abnormal AB/TU + MO2-igfbp7 standard conditions text only from Hooper et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO2-igfbp7 standard conditions Fig. 5 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal y1Tg + MO2-igfbp7 standard conditions Fig. 5 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO2-igfbp7 standard conditions Fig. 5 from Hooper et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.