Morpholino

MO2-gna13b

ID
ZDB-MRPHLNO-110608-2
Name
MO2-gna13b
Previous Names
  • gna13b-ATG-MO (1)
Target
Sequence
5' - TGCAGGAAATACGCCATCTTTGTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gna13b
Expressed Gene Anatomy Figures
gata1a Fig. 4,  Fig. 6 from Ye et al., 2011
gata2a Fig. 6 from Ye et al., 2011
kdrl Fig. 4,  Fig. 6 from Ye et al., 2011
spi1b Fig. 4,  Fig. 6 from Ye et al., 2011
tal1 Fig. 6 from Ye et al., 2011
Phenotype
Phenotype resulting from MO2-gna13b
Phenotype Fish Figures
angiogenesis process quality, abnormal WT + MO2-gna13b Fig. 2,  Fig. 4 from Ye et al., 2011
blood cell absent, abnormal WT + MO2-gna13b Fig. 3,  Fig. 5 from Ye et al., 2011
blood cell decreased amount, abnormal WT + MO2-gna13b Fig. 3 from Ye et al., 2011
blood circulation decreased process quality, abnormal WT + MO2-gna13b Fig. 3 from Ye et al., 2011
blood island apoptotic process increased occurrence, abnormal WT + MO2-gna13b Fig. 5 from Ye et al., 2011
dorsal aorta shortened, abnormal WT + MO2-gna13b Fig. 2,  Fig. 5 from Ye et al., 2011
hemopoiesis process quality, abnormal WT + MO2-gna13b Fig. 2,  Fig. 3,  Fig. 4 from Ye et al., 2011
intersegmental vessel absent, abnormal WT + MO2-gna13b Fig. 5 from Ye et al., 2011
intersegmental vessel morphology, abnormal WT + MO2-gna13b Fig. 2 from Ye et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO2-gna13b Fig. 2 from Ye et al., 2011
Phenotype of all Fish created by or utilizing MO2-gna13b
Phenotype Fish Conditions Figures
blood circulation decreased process quality, abnormal WT + MO2-gna13b standard conditions Fig. 3 from Ye et al., 2011
dorsal aorta shortened, abnormal WT + MO2-gna13b standard conditions Fig. 2,  Fig. 5 from Ye et al., 2011
hemopoiesis process quality, abnormal WT + MO2-gna13b standard conditions Fig. 2,  Fig. 3,  Fig. 4 from Ye et al., 2011
blood island apoptotic process increased occurrence, abnormal WT + MO2-gna13b standard conditions Fig. 5 from Ye et al., 2011
blood cell decreased amount, abnormal WT + MO2-gna13b standard conditions Fig. 3 from Ye et al., 2011
intersegmental vessel absent, abnormal WT + MO2-gna13b standard conditions Fig. 5 from Ye et al., 2011
angiogenesis process quality, abnormal WT + MO2-gna13b standard conditions Fig. 2,  Fig. 4 from Ye et al., 2011
intersegmental vessel morphology, abnormal WT + MO2-gna13b standard conditions Fig. 2 from Ye et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO2-gna13b standard conditions Fig. 2 from Ye et al., 2011
blood cell absent, abnormal WT + MO2-gna13b standard conditions Fig. 3,  Fig. 5 from Ye et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.