Morpholino
MO1-emilin1a
- ID
- ZDB-MRPHLNO-110607-8
- Name
- MO1-emilin1a
- Previous Names
- None
- Target
- Sequence
-
5' - AGTCCGATACCTGTGGTGAGATATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-emilin1a
No data available
Phenotype
Phenotype resulting from MO1-emilin1a
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-emilin1a
1 - 5 of 10 Show all
Citations
- Iacomino, M., Doliana, R., Marchese, M., Capuano, A., Striano, P., Spessotto, P., Bosisio, G., Iodice, R., Manganelli, F., Lanteri, P., Orsini, A., Baldassari, S., Baratto, S., Fruscione, F., Prada, V., Broda, P., Tessa, A., Bertocci, G., Schenone, A., Colombatti, A., Minetti, C., Santorelli, F.M., Zara, F., Fiorillo, C. (2020) Distal motor neuropathy associated with novel EMILIN1 mutation. Neurobiology of disease. 137:104757
- Tijssen, M.R., Cvejic, A., Joshi, A., Hannah, R.L., Ferreira, R., Forrai, A., Bellissimo, D.C., Oram, S.H., Smethurst, P.A., Wilson, N.K., Wang, X., Ottersbach, K., Stemple, D.L., Green, A.R., Ouwehand, W.H., and Göttgens, B. (2011) Genome-wide Analysis of Simultaneous GATA1/2, RUNX1, FLI1, and SCL Binding in Megakaryocytes Identifies Hematopoietic Regulators. Developmental Cell. 20(5):597-609
1 - 2 of 2
Show