Morpholino

MO1-ncor2

ID
ZDB-MRPHLNO-110607-3
Name
MO1-ncor2
Previous Names
None
Target
Sequence
5' - GTTATTCTGCGAGCACAGAAAATCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ncor2
Expressed Gene Anatomy Figures
dll4 Fig. 4 from Wei et al., 2014
efnb2a Fig. 4 from Wei et al., 2014
fosab Fig. 2 from Wei et al., 2014
myb Fig. 1,  Fig. 3,  Fig. 6 from Wei et al., 2014
rag1 Fig. 1 from Wei et al., 2014
runx1 Fig. 1,  Fig. 3,  Fig. 5,  Fig. 6 from Wei et al., 2014
vegfd Fig. 5 from Wei et al., 2014
Phenotype
Phenotype resulting from MO1-ncor2
Phenotype Fish Figures
artery increased size, abnormal y1Tg + MO1-ncor2 Fig. 4 from Wei et al., 2014
dorsal aorta increased size, abnormal y1Tg + MO1-ncor2 Fig. 4 from Wei et al., 2014
hematopoietic stem cell decreased amount, abnormal la2Tg + MO1-ncor2 Fig. 5 with image from Tijssen et al., 2011
histone H3K9 acetyltransferase activity increased occurrence, abnormal AB + MO1-ncor2 Fig. 2 from Wei et al., 2014
histone H3K27 acetyltransferase activity increased occurrence, abnormal AB + MO1-ncor2 Fig. 2 from Wei et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-ncor2 Fig. 5 with image from Tijssen et al., 2011
thrombocyte decreased amount, abnormal la2Tg + MO1-ncor2 Fig. 5 with image from Tijssen et al., 2011
Phenotype of all Fish created by or utilizing MO1-ncor2
Phenotype Fish Conditions Figures
histone H3K27 acetyltransferase activity increased occurrence, abnormal AB + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
histone H3K9 acetyltransferase activity increased occurrence, abnormal AB + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-ncor2 standard conditions Fig. 5 with image from Tijssen et al., 2011
thrombocyte decreased amount, abnormal la2Tg + MO1-ncor2 standard conditions Fig. 5 with image from Tijssen et al., 2011
hematopoietic stem cell decreased amount, abnormal la2Tg + MO1-ncor2 standard conditions Fig. 5 with image from Tijssen et al., 2011
artery increased size, abnormal y1Tg + MO1-ncor2 control Fig. 4 from Wei et al., 2014
dorsal aorta increased size, abnormal y1Tg + MO1-ncor2 control Fig. 4 from Wei et al., 2014
histone H3K27 acetyltransferase activity increased occurrence, abnormal AB + MO1-hdac3 + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
histone H3K9 acetyltransferase activity increased occurrence, abnormal AB + MO1-hdac3 + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal pku6Tg; zf169Tg + MO1-ncor2 standard conditions Fig. 1,  Fig. 3 from Wei et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.