Morpholino
MO1-mapk9
- ID
- ZDB-MRPHLNO-110322-2
- Name
- MO1-mapk9
- Previous Names
-
- jnk2-MO (1)
- Target
- Sequence
-
5' - AAAAACAGCATTACCATTCTCCTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mapk9
Expressed Gene | Anatomy | Figures |
---|---|---|
ctslb |
Fig. 3
from Seo et al., 2010 |
|
dlx3b |
Fig. 3
from Seo et al., 2010 |
|
pax2a |
Fig. 3
from Seo et al., 2010 |
|
tbxta |
Fig. 3
from Seo et al., 2010 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-mapk9
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-mapk9
1 - 4 of 4
Citations
- Gebruers, E., Cordero-Maldonado, M.L., Gray, A.I., Clements, C., Harvey, A.L., Edrada-Ebel, R., de Witte, P.A., Crawford, A.D., and Esguerra, C.V. (2013) A Phenotypic Screen in Zebrafish Identifies a Novel Small-Molecule Inducer of Ectopic Tail Formation Suggestive of Alterations in Non-Canonical Wnt/PCP Signaling. PLoS One. 8(12):e83293
- Seo, J., Asaoka, Y., Nagai, Y., Hirayama, J., Yamasaki, T., Namae, M., Ohata, S., Shimizu, N., Negishi, T., Kitagawa, D., Kondoh, H., Furutani-Seiki, M., Penninger, J.M., Katada, T., and Nishina, H. (2010) Negative regulation of wnt11 expression by Jnk signaling during zebrafish gastrulation. Journal of cellular biochemistry. 110(4):1022-1037
1 - 2 of 2
Show