ZFIN ID: ZDB-MRPHLNO-110322-2
Morpholino Name: MO1-mapk9
Target: mapk9 (1)
Previous Name: jnk2-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAAAACAGCATTACCATTCTCCTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mapk9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mapk9
Expressed Gene Anatomy Figures
ctslb Fig. 3 from Seo et al., 2010
dlx3b Fig. 3 from Seo et al., 2010
pax2a Fig. 3 from Seo et al., 2010
tbxta Fig. 3 from Seo et al., 2010
PHENOTYPE
Phenotype resulting from MO1-mapk9
Phenotype of all Fish created by or utilizing MO1-mapk9
Genome Resources:
CITATIONS (2)