ZFIN ID: ZDB-MRPHLNO-110314-3
Morpholino Name: MO1-map2k7
Target: map2k7 (1)
Previous Name: mkk7 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGAGGAACTCACCAGAGAAATGCCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-map2k7 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-map2k7
Expressed Gene Anatomy Figures
cdh1 Fig. 4 from Seo et al., 2010
ctslb Fig. 2 from Seo et al., 2010
dlx3b Fig. 2 from Seo et al., 2010
myod1 Fig. 2 from Seo et al., 2010
pax2a Fig. 2 from Seo et al., 2010
slc39a6 Fig. 4 from Seo et al., 2010
stat3 Fig. 4 from Seo et al., 2010
wnt5b Fig. 4 from Seo et al., 2010
wnt11f2 Fig. 4 from Seo et al., 2010
PHENOTYPE
Phenotype resulting from MO1-map2k7
Phenotype of all Fish created by or utilizing MO1-map2k7
Genome Resources:
CITATIONS (1)