Morpholino
MO1-map2k7
- ID
- ZDB-MRPHLNO-110314-3
- Name
- MO1-map2k7
- Previous Names
-
- mkk7 MO (1)
- Target
- Sequence
-
5' - AGAGGAACTCACCAGAGAAATGCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-map2k7
Expressed Gene | Anatomy | Figures |
---|---|---|
cdh1 |
Fig. 4
from Seo et al., 2010 |
|
ctslb |
Fig. 2
from Seo et al., 2010 |
|
dlx3b |
Fig. 2
from Seo et al., 2010 |
|
myod1 |
Fig. 2
from Seo et al., 2010 |
|
pax2a |
Fig. 2
from Seo et al., 2010 |
|
slc39a6 |
Fig. 4
from Seo et al., 2010 |
|
stat3 |
Fig. 4
from Seo et al., 2010 |
|
wnt5b |
Fig. 4
from Seo et al., 2010 |
|
wnt11f2 |
Fig. 4
from Seo et al., 2010 |
Phenotype
Phenotype resulting from MO1-map2k7
Phenotype | Fish | Figures |
---|---|---|
somite irregular spatial pattern, abnormal | WT + MO1-map2k7 |
Fig. 2
from Seo et al., 2010 |
whole organism decreased length, abnormal | WT + MO1-map2k7 |
Fig. 2
from Seo et al., 2010 |
Phenotype of all Fish created by or utilizing MO1-map2k7
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism decreased length, abnormal | WT + MO1-map2k7 | standard conditions |
Fig. 2
from Seo et al., 2010 |
somite irregular spatial pattern, abnormal | WT + MO1-map2k7 | standard conditions |
Fig. 2
from Seo et al., 2010 |
Citations