Morpholino

MO2-neo1a

ID
ZDB-MRPHLNO-110301-10
Name
MO2-neo1a
Previous Names
  • ATG-MO (1)
Target
Sequence
5' - GGCTCCCCGCTCCGCCATCACTTTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 7
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-neo1a
Expressed Gene Anatomy Figures
dbx1a Fig. 5 with image from Mawdsley et al., 2004
egr2b Fig. 6 with image from Mawdsley et al., 2004
isl1a Fig. 5 with image from Mawdsley et al., 2004
pax2a Fig. 5 with image,  Fig. 6 with image from Mawdsley et al., 2004
shha Fig. 6 with image from Mawdsley et al., 2004
Phenotype
Phenotype resulting from MO2-neo1a
Phenotype Fish Figures
brain morphology, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
brain structure, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
brain anterior-posterior axis decreased size, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
brainstem and spinal white matter axon decreased amount, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
CaP motoneuron axon decreased amount, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
cerebellum morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
diencephalon lacks all parts of type third ventricle, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
diencephalon morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
dorsal longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
dorso-rostral cluster neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
eye decreased size, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
head flattened, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
hindbrain morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
hindbrain neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
hindbrain interneuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
hindbrain neural keel cell morphogenesis process quality, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
hindbrain neural keel microtubule disorganized, abnormal AB + MO2-neo1a Fig. 9 from Brown et al., 2019
hindbrain neural keel microtubule mislocalised, abnormal AB + MO2-neo1a Fig. 9 from Brown et al., 2019
hindbrain neural keel microtubule shortened, abnormal AB + MO2-neo1a Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell circular, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell shape, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
medial longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
multicellular organism development disrupted, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
nervous system development disrupted, abnormal WT + MO2-neo1a Fig. 2 with image,  Fig. 4 with image,  Fig. 5 with image,  text only from Mawdsley et al., 2004
neural plate increased width, abnormal AB + MO2-neo1a Fig. 6 from Brown et al., 2019
neural tube duplicated, abnormal AB + MO2-neo1a Fig. 8 from Brown et al., 2019
neural tube unlumenized, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neural tube development disrupted, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell decreased amount, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell mislocalised, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell cell morphogenesis process quality, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
pericardium edematous, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
post-vent region increased curvature, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
primary motor neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
Rohon-Beard neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
somite decreased thickness, abnormal WT + MO2-neo1a Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
somite elongated, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
somite flattened, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
somite increased width, abnormal WT + MO2-neo1a Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
somite morphology, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
somite U-shaped, abnormal WT + MO2-neo1a Fig. 3 with image,  Fig. 8 with image,  text only from Mawdsley et al., 2004
somitogenesis disrupted, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
tegmentum morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
trigeminal ganglion neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
whole organism decreased length, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
whole organism decreased pigmentation, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
whole organism necrotic, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
whole organism viability, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-neo1a Fig. 2 with image,  text only from Mawdsley et al., 2004
whole organism anterior-posterior axis shortened, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
Phenotype of all Fish created by or utilizing MO2-neo1a
Phenotype Fish Conditions Figures
hindbrain neural keel microtubule shortened, abnormal AB + MO2-neo1a standard conditions Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell shape, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
hindbrain neural keel microtubule disorganized, abnormal AB + MO2-neo1a standard conditions Fig. 9 from Brown et al., 2019
whole organism anterior-posterior axis shortened, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
eye decreased size, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
neural plate increased width, abnormal AB + MO2-neo1a standard conditions Fig. 6 from Brown et al., 2019
somite morphology, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
brain morphology, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
hindbrain neural keel cell morphogenesis process quality, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
hindbrain neural keel microtubule mislocalised, abnormal AB + MO2-neo1a standard conditions Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell circular, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
neuroepithelial cell cell morphogenesis process quality, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
neural tube duplicated, abnormal AB + MO2-neo1a standard conditions Fig. 8 from Brown et al., 2019
whole organism decreased pigmentation, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
diencephalon lacks all parts of type third ventricle, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
whole organism viability, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
head flattened, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
primary motor neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
tegmentum morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
neuroepithelial cell decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
hindbrain neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
dorso-rostral cluster neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
trigeminal ganglion neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
post-vent region increased curvature, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
neural tube unlumenized, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  text only from Mawdsley et al., 2004
brainstem and spinal white matter axon decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
dorsal longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
somite elongated, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
pericardium edematous, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
CaP motoneuron axon decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
diencephalon morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
neural tube development disrupted, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
brain anterior-posterior axis decreased size, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
neuroepithelial cell mislocalised, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
somite flattened, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
hindbrain morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
somitogenesis disrupted, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
whole organism necrotic, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
nervous system development disrupted, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 5 with image,  text only from Mawdsley et al., 2004
somite U-shaped, abnormal WT + MO2-neo1a standard conditions Fig. 3 with image,  Fig. 8 with image,  text only from Mawdsley et al., 2004
medial longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
Rohon-Beard neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
multicellular organism development disrupted, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
somite decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
hindbrain interneuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
somite increased width, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
whole organism decreased length, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
cerebellum morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
brain structure, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
Citations
TSV
1 - 4 of 4
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.