Morpholino

MO2-neo1a

ID
ZDB-MRPHLNO-110301-10
Name
MO2-neo1a
Previous Names
  • ATG-MO (1)
Target
Sequence
5' - GGCTCCCCGCTCCGCCATCACTTTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-neo1a
No data available
Phenotype
Phenotype resulting from MO2-neo1a
Phenotype Fish Figures
brain morphology, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
brain structure, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
brain anterior-posterior axis decreased size, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
brainstem and spinal white matter axon decreased amount, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
CaP motoneuron axon decreased amount, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
cerebellum morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
diencephalon lacks all parts of type third ventricle, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
diencephalon morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
dorsal longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
dorso-rostral cluster neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
eye decreased size, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
head flattened, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
hindbrain morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
hindbrain neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
hindbrain interneuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
hindbrain neural keel cell morphogenesis process quality, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
hindbrain neural keel microtubule disorganized, abnormal AB + MO2-neo1a Fig. 9 from Brown et al., 2019
hindbrain neural keel microtubule mislocalised, abnormal AB + MO2-neo1a Fig. 9 from Brown et al., 2019
hindbrain neural keel microtubule shortened, abnormal AB + MO2-neo1a Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell circular, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell shape, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
medial longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a Fig. 4 with image from Mawdsley et al., 2004
multicellular organism development disrupted, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
nervous system development disrupted, abnormal WT + MO2-neo1a Fig. 2 with image,  Fig. 4 with image,  Fig. 5 with image,  text only from Mawdsley et al., 2004
neural plate increased width, abnormal AB + MO2-neo1a Fig. 6 from Brown et al., 2019
neural tube duplicated, abnormal AB + MO2-neo1a Fig. 8 from Brown et al., 2019
neural tube unlumenized, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neural tube development disrupted, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell decreased amount, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell mislocalised, abnormal WT + MO2-neo1a Fig. 7 with image from Mawdsley et al., 2004
neuroepithelial cell cell morphogenesis process quality, abnormal AB + MO2-neo1a Fig. 3 from Brown et al., 2019
pericardium edematous, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
post-vent region increased curvature, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
primary motor neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
Rohon-Beard neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
somite decreased thickness, abnormal WT + MO2-neo1a Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
somite elongated, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
somite flattened, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
somite increased width, abnormal WT + MO2-neo1a Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
somite morphology, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
somite U-shaped, abnormal WT + MO2-neo1a Fig. 3 with image,  Fig. 8 with image,  text only from Mawdsley et al., 2004
somitogenesis disrupted, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
tegmentum morphology, abnormal WT + MO2-neo1a Fig. 2 with image from Mawdsley et al., 2004
trigeminal ganglion neuron decreased amount, abnormal WT + MO2-neo1a Fig. 5 with image from Mawdsley et al., 2004
whole organism decreased length, abnormal WT + MO2-neo1a Fig. S4 with image from Gibert et al., 2011
whole organism decreased pigmentation, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
whole organism necrotic, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
whole organism viability, abnormal WT + MO2-neo1a text only from Mawdsley et al., 2004
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-neo1a Fig. 2 with image,  text only from Mawdsley et al., 2004
whole organism anterior-posterior axis shortened, abnormal AB + MO2-neo1a Fig. 2 from Brown et al., 2019
Phenotype of all Fish created by or utilizing MO2-neo1a
Phenotype Fish Conditions Figures
hindbrain neural keel microtubule shortened, abnormal AB + MO2-neo1a standard conditions Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell shape, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
hindbrain neural keel microtubule disorganized, abnormal AB + MO2-neo1a standard conditions Fig. 9 from Brown et al., 2019
whole organism anterior-posterior axis shortened, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
eye decreased size, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
neural plate increased width, abnormal AB + MO2-neo1a standard conditions Fig. 6 from Brown et al., 2019
somite morphology, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
brain morphology, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
hindbrain neural keel cell morphogenesis process quality, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
hindbrain neural keel microtubule mislocalised, abnormal AB + MO2-neo1a standard conditions Fig. 9 from Brown et al., 2019
hindbrain neural keel neuroepithelial cell circular, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
neuroepithelial cell cell morphogenesis process quality, abnormal AB + MO2-neo1a control Fig. 3 from Brown et al., 2019
neural tube duplicated, abnormal AB + MO2-neo1a standard conditions Fig. 8 from Brown et al., 2019
whole organism decreased pigmentation, abnormal AB + MO2-neo1a standard conditions Fig. 2 from Brown et al., 2019
diencephalon lacks all parts of type third ventricle, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
whole organism viability, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
head flattened, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
primary motor neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
tegmentum morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
neuroepithelial cell decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
hindbrain neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
dorso-rostral cluster neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
trigeminal ganglion neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
post-vent region increased curvature, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
neural tube unlumenized, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  text only from Mawdsley et al., 2004
brainstem and spinal white matter axon decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
dorsal longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
somite elongated, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
pericardium edematous, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
CaP motoneuron axon decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
diencephalon morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
neural tube development disrupted, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
brain anterior-posterior axis decreased size, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
neuroepithelial cell mislocalised, abnormal WT + MO2-neo1a standard conditions Fig. 7 with image from Mawdsley et al., 2004
somite flattened, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
hindbrain morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
somitogenesis disrupted, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
whole organism necrotic, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
nervous system development disrupted, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 5 with image,  text only from Mawdsley et al., 2004
somite U-shaped, abnormal WT + MO2-neo1a standard conditions Fig. 3 with image,  Fig. 8 with image,  text only from Mawdsley et al., 2004
medial longitudinal fasciculus decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 4 with image from Mawdsley et al., 2004
Rohon-Beard neuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
multicellular organism development disrupted, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
somite decreased thickness, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
hindbrain interneuron decreased amount, abnormal WT + MO2-neo1a standard conditions Fig. 5 with image from Mawdsley et al., 2004
somite increased width, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image,  Fig. 8 with image from Mawdsley et al., 2004
whole organism decreased length, abnormal WT + MO2-neo1a standard conditions Fig. S4 with image from Gibert et al., 2011
cerebellum morphology, abnormal WT + MO2-neo1a standard conditions Fig. 2 with image from Mawdsley et al., 2004
brain structure, abnormal WT + MO2-neo1a standard conditions text only from Mawdsley et al., 2004
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO2-neo1a standard conditions Fig. 5 with image from Gao et al., 2012
Citations