Morpholino

MO1-rock2b

ID
ZDB-MRPHLNO-110119-3
Name
MO1-rock2b
Previous Names
None
Target
Sequence
5' - GCACACACTCACTCACCAGCTGCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rock2b
No data available
Phenotype
Phenotype resulting from MO1-rock2b
Phenotype Fish Figures
cell apical side increased width, abnormal pt19Tg + MO1-rock2b (AB) Fig. 7 with image from Wang et al., 2011
cell apical surface increased size, abnormal AB + MO1-rock2b Fig. 7 with image from Wang et al., 2011
determination of digestive tract left/right asymmetry decreased occurrence, abnormal WT + MO1-rock2b Fig. S4 from Ferreira et al., 2018
determination of digestive tract left/right asymmetry occurrence, abnormal WT + MO1-rock2b Fig. S4 from Ferreira et al., 2018
determination of heart left/right asymmetry decreased occurrence, abnormal WT + MO1-rock2b Fig. S4 from Ferreira et al., 2018
determination of heart left/right asymmetry occurrence, abnormal WT + MO1-rock2b Fig. S4 from Ferreira et al., 2018
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-rock2b Fig. S4 from Ferreira et al., 2018
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO1-rock2b Fig. 4 with image from Wang et al., 2011
determination of left/right asymmetry in lateral mesoderm occurrence, abnormal WT + MO1-rock2b Fig. S4 from Ferreira et al., 2018
determination of liver left/right asymmetry disrupted, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
heart looping disrupted, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
heart tube centered, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
heart tube inverted, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle decreased functionality, abnormal AB + MO1-rock2b Fig. 6 with image from Wang et al., 2011
Kupffer's vesicle cell cellular quality, abnormal pt19Tg + MO1-rock2b (AB) Fig. 7 with image from Wang et al., 2011
Kupffer's vesicle cell shape, abnormal pt19Tg + MO1-rock2b (AB) Fig. 7 with image from Wang et al., 2011
Kupffer's vesicle cell structure, abnormal AB + MO1-rock2b Fig. 7 with image from Wang et al., 2011
Kupffer's vesicle cilium spatial pattern, abnormal AB + MO1-rock2b Fig. 5 with image from Wang et al., 2011
Kupffer's vesicle cilium symmetry, abnormal AB + MO1-rock2b Fig. 5 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance circling direction, abnormal AB + MO1-rock2b Fig. 6 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance decreased fluid flow, abnormal AB + MO1-rock2b Fig. 6 with image from Wang et al., 2011
lateral plate mesoderm bilateral symmetry, abnormal AB + MO1-rock2b Fig. 4 with image from Wang et al., 2011
lateral plate mesoderm symmetry, abnormal AB + MO1-rock2b Fig. 4 with image from Wang et al., 2011
liver inverted, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
liver symmetry, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
pancreas inverted, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
pancreas symmetry, abnormal AB + MO1-rock2b Fig. 3 with image from Wang et al., 2011
Phenotype of all Fish created by or utilizing MO1-rock2b
Phenotype Fish Conditions Figures
Kupffer's vesicle decreased functionality, abnormal AB + MO1-rock2b standard conditions Fig. 6 with image from Wang et al., 2011
Kupffer's vesicle cell structure, abnormal AB + MO1-rock2b standard conditions Fig. 7 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance circling direction, abnormal AB + MO1-rock2b standard conditions Fig. 6 with image from Wang et al., 2011
determination of liver left/right asymmetry disrupted, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance decreased fluid flow, abnormal AB + MO1-rock2b standard conditions Fig. 6 with image from Wang et al., 2011
liver inverted, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
heart looping disrupted, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
pancreas symmetry, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle cilium symmetry, abnormal AB + MO1-rock2b standard conditions Fig. 5 with image from Wang et al., 2011
cell apical surface increased size, abnormal AB + MO1-rock2b standard conditions Fig. 7 with image from Wang et al., 2011
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO1-rock2b standard conditions Fig. 4 with image from Wang et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
lateral plate mesoderm symmetry, abnormal AB + MO1-rock2b standard conditions Fig. 4 with image from Wang et al., 2011
pancreas inverted, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
liver symmetry, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
heart tube centered, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
lateral plate mesoderm bilateral symmetry, abnormal AB + MO1-rock2b standard conditions Fig. 4 with image from Wang et al., 2011
heart tube inverted, abnormal AB + MO1-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle cilium spatial pattern, abnormal AB + MO1-rock2b standard conditions Fig. 5 with image from Wang et al., 2011
determination of heart left/right asymmetry occurrence, abnormal WT + MO1-rock2b standard conditions Fig. S4 from Ferreira et al., 2018
determination of digestive tract left/right asymmetry decreased occurrence, abnormal WT + MO1-rock2b standard conditions Fig. S4 from Ferreira et al., 2018
determination of left/right asymmetry in lateral mesoderm occurrence, abnormal WT + MO1-rock2b standard conditions Fig. S4 from Ferreira et al., 2018
determination of heart left/right asymmetry decreased occurrence, abnormal WT + MO1-rock2b standard conditions Fig. S4 from Ferreira et al., 2018
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-rock2b standard conditions Fig. S4 from Ferreira et al., 2018
determination of digestive tract left/right asymmetry occurrence, abnormal WT + MO1-rock2b standard conditions Fig. S4 from Ferreira et al., 2018
Kupffer's vesicle cell cellular quality, abnormal pt19Tg + MO1-rock2b (AB) standard conditions Fig. 7 with image from Wang et al., 2011
Kupffer's vesicle cell shape, abnormal pt19Tg + MO1-rock2b (AB) standard conditions Fig. 7 with image from Wang et al., 2011
cell apical side increased width, abnormal pt19Tg + MO1-rock2b (AB) standard conditions Fig. 7 with image from Wang et al., 2011
Citations