Morpholino

MO2-sox11b

ID
ZDB-MRPHLNO-110113-1
Name
MO2-sox11b
Previous Names
  • Sox11bvivo-morpholino (1)
Target
Sequence
5' - CTGTGCTCCGTCTGCTGCACCATGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox11b
Expressed Gene Anatomy Figures
ascl1a Fig. t3 from Guo et al., 2011
nes Fig. t3 from Guo et al., 2011
Phenotype
Phenotype resulting from MO2-sox11b
Phenotype Fish Figures
brain cell apoptotic, abnormal WT + MO2-sox11b Fig. S6 from Tsurusaki et al., 2014
spinal cord ependymal cell proliferative, abnormal WT + MO2-sox11b Fig. 3 from Guo et al., 2011
whole organism lethal (sensu genetics), abnormal WT + MO2-sox11b Fig. 4 from Tsurusaki et al., 2014
Phenotype of all Fish created by or utilizing MO2-sox11b
Phenotype Fish Conditions Figures
brain cell apoptotic, abnormal WT + MO2-sox11b standard conditions Fig. S6 from Tsurusaki et al., 2014
spinal cord ependymal cell proliferative, abnormal WT + MO2-sox11b standard conditions Fig. 3 from Guo et al., 2011
whole organism lethal (sensu genetics), abnormal WT + MO2-sox11b standard conditions Fig. 4 from Tsurusaki et al., 2014
telencephalon neuron decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. S7 from Tsurusaki et al., 2014
hindbrain commissure disorganized, abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. S7 from Tsurusaki et al., 2014
whole organism lethal (sensu genetics), abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. 4 from Tsurusaki et al., 2014
central nervous system apoptotic, abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. 4 from Tsurusaki et al., 2014
brain cell apoptotic, abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. S6 from Tsurusaki et al., 2014
head decreased size, abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. 4 from Tsurusaki et al., 2014
hindbrain axon decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. S7 from Tsurusaki et al., 2014
diencephalon neuron decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a standard conditions Fig. S7 from Tsurusaki et al., 2014
telencephalon neuron decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
diencephalon neuron decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
central nervous system apoptotic, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. 4 from Tsurusaki et al., 2014
hindbrain commissure disorganized, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
hindbrain axon decreased amount, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. S7 from Tsurusaki et al., 2014
head decreased size, abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. 4 from Tsurusaki et al., 2014
whole organism lethal (sensu genetics), abnormal WT + MO2-sox11b + MO3-sox11a + MO4-tp53 standard conditions Fig. 4 from Tsurusaki et al., 2014
brain cell apoptotic, abnormal tp53zdf1/zdf1 + MO2-sox11b + MO3-sox11a standard conditions Fig. S6 from Tsurusaki et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.