ZFIN ID: ZDB-MRPHLNO-110111-3
Morpholino Name: MO2-zbtb4
Target: zbtb4 (1)
Previous Name: kzp MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTGCTTATTTCTGTGTTTCATTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-zbtb4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-zbtb4
Expressed Gene Anatomy Figures
chrd Fig. 2 from Yao et al., 2010
ctslb Fig. 3 from Yao et al., 2010
dlx3b Fig. 3 from Yao et al., 2010
eve1 Fig. 2Fig. 7 from Yao et al., 2010
myod1 Fig. 3 from Yao et al., 2010
noto Fig. 2 from Yao et al., 2010
pcdh8 Fig. 3 from Yao et al., 2010
tbx16l Fig. 2Fig. 7 from Yao et al., 2010
tbxta Fig. 3 from Yao et al., 2010
wnt8a Fig. 5 from Yao et al., 2010
PHENOTYPE
Phenotype resulting from MO2-zbtb4
Phenotype of all Fish created by or utilizing MO2-zbtb4
Genome Resources:
CITATIONS (1)