Morpholino

MO1-zbtb4

ID
ZDB-MRPHLNO-110111-2
Name
MO1-zbtb4
Previous Names
  • kzp MO1 (1)
Target
Sequence
5' - TGCCTCCTCTGTGCCCTCTCCCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 12
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zbtb4
Expressed Gene Anatomy Figures
chrd Fig. 2 from Yao et al., 2010
ctslb Fig. 3 from Yao et al., 2010
dlx3b Fig. 3 from Yao et al., 2010
eve1 Fig. 2,  Fig. 7 from Yao et al., 2010
gata1a Fig. 2,  Fig. 4,  Fig. 6 from Liu et al., 2012
gata2a Fig. 1,  Fig. 4 from Liu et al., 2012
hbbe1.1 Fig. 2,  Fig. 4,  Fig. 6 from Liu et al., 2012
lcp1 Fig. 3 from Liu et al., 2012
lmo2 Fig. 1,  Fig. 4 from Liu et al., 2012
mpx Fig. 3 from Liu et al., 2012
myb Fig. 4 from Liu et al., 2012
myod1 Fig. 3 from Yao et al., 2010
noto Fig. 2 from Yao et al., 2010
pcdh8 Fig. 3 from Yao et al., 2010
runx1 Fig. 4 from Liu et al., 2012
spi1b Fig. 3,  Fig. 4,  Fig. 6 from Liu et al., 2012
tal1 Fig. 1,  Fig. 4,  Fig. 6 from Liu et al., 2012
tbx16l Fig. 2,  Fig. 7 from Yao et al., 2010
tbxta Fig. 3 from Yao et al., 2010
wnt8a Fig. 5 from Yao et al., 2010
Phenotype
Phenotype resulting from MO1-zbtb4
Phenotype Fish Figures
anterior lateral plate mesoderm mpx expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 3 from Liu et al., 2012
anterior lateral plate mesoderm spi1b expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 3 from Liu et al., 2012
anterior lateral plate mesoderm lcp1 expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 3 from Liu et al., 2012
convergent extension disrupted, abnormal WT + MO1-zbtb4 Fig. 3 from Yao et al., 2010
post-vent region absent, abnormal WT + MO1-zbtb4 Fig. 7 from Yao et al., 2010
post-vent region curved dorsal, abnormal WT + MO1-zbtb4 Fig. 2 from Yao et al., 2010
post-vent region decreased size, abnormal WT + MO1-zbtb4 Fig. 2 from Yao et al., 2010
posterior lateral plate mesoderm gata2a expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 1 from Liu et al., 2012
posterior lateral plate mesoderm spi1b expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 6 from Liu et al., 2012
posterior lateral plate mesoderm tal1 expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 1,  Fig. 6 from Liu et al., 2012
posterior lateral plate mesoderm hbbe1.1 expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 2,  Fig. 6 from Liu et al., 2012
posterior lateral plate mesoderm gata1a expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 2,  Fig. 6 from Liu et al., 2012
whole organism gata1a expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 4 from Liu et al., 2012
whole organism spi1b expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 4 from Liu et al., 2012
whole organism tal1 expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 4 from Liu et al., 2012
whole organism gata2a expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 4 from Liu et al., 2012
whole organism hbbe1.1 expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 4 from Liu et al., 2012
whole organism runx1 expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 4 from Liu et al., 2012
whole organism myb expression decreased amount, abnormal WT + MO1-zbtb4 Fig. 4 from Liu et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-zbtb4 Fig. 2 from Yao et al., 2010
Phenotype of all Fish created by or utilizing MO1-zbtb4
Phenotype Fish Conditions Figures
whole organism myb expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 4 from Liu et al., 2012
whole organism tal1 expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 4 from Liu et al., 2012
whole organism runx1 expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 4 from Liu et al., 2012
anterior lateral plate mesoderm lcp1 expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 3 from Liu et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-zbtb4 standard conditions Fig. 2 from Yao et al., 2010
whole organism hbbe1.1 expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 4 from Liu et al., 2012
anterior lateral plate mesoderm spi1b expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 3 from Liu et al., 2012
anterior lateral plate mesoderm mpx expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 3 from Liu et al., 2012
post-vent region absent, abnormal WT + MO1-zbtb4 standard conditions Fig. 7 from Yao et al., 2010
whole organism gata2a expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 4 from Liu et al., 2012
posterior lateral plate mesoderm gata2a expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 1 from Liu et al., 2012
post-vent region decreased size, abnormal WT + MO1-zbtb4 standard conditions Fig. 2 from Yao et al., 2010
posterior lateral plate mesoderm spi1b expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 6 from Liu et al., 2012
posterior lateral plate mesoderm hbbe1.1 expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 2,  Fig. 6 from Liu et al., 2012
whole organism spi1b expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 4 from Liu et al., 2012
post-vent region curved dorsal, abnormal WT + MO1-zbtb4 standard conditions Fig. 2 from Yao et al., 2010
convergent extension disrupted, abnormal WT + MO1-zbtb4 standard conditions Fig. 3 from Yao et al., 2010
whole organism gata1a expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 4 from Liu et al., 2012
posterior lateral plate mesoderm tal1 expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 1,  Fig. 6 from Liu et al., 2012
posterior lateral plate mesoderm gata1a expression decreased amount, abnormal WT + MO1-zbtb4 standard conditions Fig. 2,  Fig. 6 from Liu et al., 2012
Citations
TSV
1 - 3 of 3
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.