Morpholino
MO1-mfn2
- ID
- ZDB-MRPHLNO-110106-1
- Name
- MO1-mfn2
- Previous Names
- None
- Target
- Sequence
-
5' - GTTTCTGTTAAAGGGAAAACGGGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mfn2
No data available
Phenotype
Phenotype resulting from MO1-mfn2
1 - 5 of 29 Show all
Phenotype of all Fish created by or utilizing MO1-mfn2
1 - 5 of 47 Show all
Citations
- Gonzaga-Jauregui, C., Harel, T., Gambin, T., Kousi, M., Griffin, L.B., Francescatto, L., Ozes, B., Karaca, E., Jhangiani, S.N., Bainbridge, M.N., Lawson, K.S., Pehlivan, D., Okamoto, Y., Withers, M., Mancias, P., Slavotinek, A., Reitnauer, P.J., Goksungur, M.T., Shy, M., Crawford, T.O., Koenig, M., Willer, J., Flores, B.N., Pediaditrakis, I., Us, O., Wiszniewski, W., Parman, Y., Antonellis, A., Muzny, D.M., Baylor-Hopkins Center for Mendelian Genomics, Katsanis, N., Battaloglu, E., Boerwinkle, E., Gibbs, R.A., Lupski, J.R. (2015) Exome Sequence Analysis Suggests that Genetic Burden Contributes to Phenotypic Variability and Complex Neuropathy. Cell Reports. 12(7):1169-83
- Vettori, A., Bergamin, G., Moro, E., Vazza, G., Polo, G., Tiso, N., Argenton, F., and Mostacciuolo, M.L. (2011) Developmental defects and neuromuscular alterations due to mitofusin 2 gene (MFN2) silencing in zebrafish: A new model for Charcot-Marie-Tooth type 2A neuropathy. Neuromuscular disorders : NMD. 21(1):58-67
1 - 2 of 2
Show