Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-abcc6a

ID
ZDB-MRPHLNO-101228-2
Name
MO1-abcc6a
Previous Names
  • abcc6a MO1 (1)
Target
Sequence
5' - CACTTAGACTGCAAAAGGTATCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation start site targeting morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-abcc6a
No data available
Phenotype
Phenotype resulting from MO1-abcc6a
Phenotype of all Fish created by or utilizing MO1-abcc6a
Citations