Morpholino
MO1-acta2
- ID
- ZDB-MRPHLNO-101220-1
- Name
- MO1-acta2
- Previous Names
-
- sma MO
- Target
- Sequence
-
5' - GCTTTCTTCGTCGTCACACATTTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-acta2
No data available
Phenotype
Phenotype resulting from MO1-acta2
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-acta2
1 - 5 of 8 Show all
Citations
- Abrams, J., Einhorn, Z., Seiler, C., Zong, A.B., Sweeney, H.L., Pack, M. (2016) Graded effects of unregulated smooth muscle myosin on intestinal architecture, intestinal motility, and vascular function in zebrafish. Disease models & mechanisms. 9(5):529-40
- Abrams, J., Davuluri, G., Seiler, C., and Pack, M. (2012) Smooth muscle caldesmon modulates peristalsis in the wild type and non-innervated zebrafish intestine. Neurogastroenterology and motility. 24(3):288-299
- Seiler, C., Davuluri, G., Abrams, J., Byfield, F.J., Janmey, P.A., and Pack, M. (2012) Smooth muscle tension induces invasive remodeling of the zebrafish intestine. PLoS Biology. 10(9):e1001386
- Davuluri, G., Seiler, C., Abrams, J., Soriano, A.J., and Pack, M. (2010) Differential effects of thin and thick filament disruption on zebrafish smooth muscle regulatory proteins. Neurogastroenterology and motility. 22(10):1100-e285
1 - 4 of 4
Show