Morpholino

MO2-tnfsf18

ID

ZDB-MRPHLNO-101109-4

Name

MO2-tnfsf18

Previous Names

Target

Sequence

5' - TTAAATGGTGACTTACAGTTTGGCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice block exon1-exon2

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tnfsf18

Expressed Gene	Anatomy	Figures
ctslb	polster	Fig. 3 from Poulton et al., 2010
dlx3b	neural plate	Fig. 3 from Poulton et al., 2010

Phenotype

Phenotype resulting from MO2-tnfsf18

Phenotype	Fish	Figures
blastoderm thickness, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
cell migration involved in gastrulation disrupted, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
epiboly involved in gastrulation with mouth forming second delayed, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
extension morphology, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
margin poorly differentiated, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
neural plate increased width, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
optic primordium hypoplastic, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
optic primordium shape, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
somite shape, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
somite border irregular spatial pattern, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
whole organism shape, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010
whole organism anterior-posterior axis decreased length, abnormal	WT + MO2-tnfsf18	Fig. 3 from Poulton et al., 2010

Phenotype of all Fish created by or utilizing MO2-tnfsf18

Phenotype	Fish	Conditions	Figures
whole organism anterior-posterior axis decreased length, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
whole organism shape, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
somite shape, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
extension morphology, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
margin poorly differentiated, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
optic primordium shape, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
epiboly involved in gastrulation with mouth forming second delayed, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
blastoderm thickness, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
cell migration involved in gastrulation disrupted, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
neural plate increased width, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
optic primordium hypoplastic, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010
somite border irregular spatial pattern, abnormal	WT + MO2-tnfsf18	standard conditions	Fig. 3 from Poulton et al., 2010

Citations