ZFIN ID: ZDB-MRPHLNO-101109-4
Morpholino Name: MO2-tnfsf18
Target: tnfsf18 (1)
Previous Name: zGL2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTAAATGGTGACTTACAGTTTGGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice block exon1-exon2
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tnfsf18 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tnfsf18
Expressed Gene Anatomy Figures
ctslb Fig. 3 with image from Poulton et al., 2010
dlx3b Fig. 3 with image from Poulton et al., 2010
PHENOTYPE
Phenotype resulting from MO2-tnfsf18
Phenotype of all Fish created by or utilizing MO2-tnfsf18
Genome Resources:
CITATIONS (1)