Morpholino

MO1-cpa6

ID
ZDB-MRPHLNO-101026-6
Name
MO1-cpa6
Previous Names
  • MO-2 (1)
Target
Sequence
5' - AGAAAATAAGGGACTCACTGTCAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino targets boundary of exon 2 and intron 2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cpa6
Phenotype
Phenotype resulting from MO1-cpa6
Phenotype of all Fish created by or utilizing MO1-cpa6
Phenotype Fish Conditions Figures
whole organism chga expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism tac1 expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism pcsk1nl expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism npy expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism edn1 expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
swimming behavior process quality, ameliorated WT + MO1-cpa6 chemical treatment: pentetrazol Fig. 1 from Lopes et al., 2016
whole organism cpe expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism bdnf expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism fosab expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism grin1a expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
swimming behavior increased occurrence, ameliorated WT + MO1-cpa6 chemical treatment: pilocarpine Fig. 2 from Lopes et al., 2016
whole organism cpa6 expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism nts expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
whole organism slc1a2b expression decreased amount, abnormal WT + MO1-cpa6 standard conditions Fig. 4 from Lopes et al., 2016
swimming behavior increased occurrence, ameliorated WT + MO1-cpa6 chemical treatment: pentetrazol Fig. 1 from Lopes et al., 2016
Citations