Morpholino

MO3-tfap2e

ID
ZDB-MRPHLNO-101013-3
Name
MO3-tfap2e
Previous Names
  • AUG MO (1)
Target
Sequence
5' - GCTGGAGTAGGAGTGGACTAACATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tfap2e
No data available
Phenotype
Phenotype resulting from MO3-tfap2e
Phenotype Fish Figures
brain decreased volume, abnormal sb2Tg + MO3-tfap2e Fig. 4 with image from Kalanithy et al., 2024
brain hydrocephalic, abnormal sb2Tg + MO3-tfap2e Fig. 4 with image from Kalanithy et al., 2024
ceratohyal cartilage morphology, abnormal AB/TL + MO3-tfap2e Fig. 3 with image from Kalanithy et al., 2024
dorsal root ganglion neuron decreased amount, abnormal sb2Tg + MO3-tfap2e Fig. 3 with image from Kalanithy et al., 2024
fourth ventricle increased size, abnormal sb2Tg + MO3-tfap2e Fig. 4 with image from Kalanithy et al., 2024
head decreased size, abnormal AB/TL + MO3-tfap2e Fig. 2 with image from Kalanithy et al., 2024
hyosymplectic cartilage morphology, abnormal AB/TL + MO3-tfap2e Fig. 3 with image from Kalanithy et al., 2024
Meckel's cartilage morphology, abnormal AB/TL + MO3-tfap2e Fig. 3 with image from Kalanithy et al., 2024
palatoquadrate cartilage morphology, abnormal AB/TL + MO3-tfap2e Fig. 3 with image from Kalanithy et al., 2024
third ventricle increased size, abnormal sb2Tg + MO3-tfap2e Fig. 4 with image from Kalanithy et al., 2024
ventral mandibular arch decreased size, abnormal AB/TL + MO3-tfap2e Fig. 3 with image from Kalanithy et al., 2024
ventral mandibular arch morphology, abnormal vu234Tg + MO3-tfap2e Fig. 3 with image from Kalanithy et al., 2024
whole organism decreased life span, abnormal AB/TL + MO3-tfap2e Fig. 2 with image from Kalanithy et al., 2024
whole organism decreased pigmentation, abnormal AB/TL + MO3-tfap2e Fig. 2 with image from Kalanithy et al., 2024
whole organism increased curvature, abnormal AB/TL + MO3-tfap2e Fig. 2 with image from Kalanithy et al., 2024
Phenotype of all Fish created by or utilizing MO3-tfap2e
Phenotype Fish Conditions Figures
whole organism decreased pigmentation, abnormal AB/TL + MO3-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
whole organism increased curvature, abnormal AB/TL + MO3-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
ceratohyal cartilage morphology, abnormal AB/TL + MO3-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
hyosymplectic cartilage morphology, abnormal AB/TL + MO3-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
head decreased size, abnormal AB/TL + MO3-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
palatoquadrate cartilage morphology, abnormal AB/TL + MO3-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
whole organism decreased life span, abnormal AB/TL + MO3-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
Meckel's cartilage morphology, abnormal AB/TL + MO3-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
ventral mandibular arch decreased size, abnormal AB/TL + MO3-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
third ventricle increased size, abnormal sb2Tg + MO3-tfap2e control Fig. 4 with image from Kalanithy et al., 2024
brain decreased volume, abnormal sb2Tg + MO3-tfap2e control Fig. 4 with image from Kalanithy et al., 2024
brain hydrocephalic, abnormal sb2Tg + MO3-tfap2e control Fig. 4 with image from Kalanithy et al., 2024
dorsal root ganglion neuron decreased amount, abnormal sb2Tg + MO3-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
fourth ventricle increased size, abnormal sb2Tg + MO3-tfap2e control Fig. 4 with image from Kalanithy et al., 2024
ventral mandibular arch morphology, abnormal vu234Tg + MO3-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
Citations