Morpholino

MO2-plk1

ID
ZDB-MRPHLNO-100908-2
Name
MO2-plk1
Previous Names
  • plk1 ATG mO (1)
Target
Sequence
5' - AATTGCAGCACTCATCGTTGTACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-plk1
No data available
Phenotype
Phenotype resulting from MO2-plk1
Phenotype of all Fish created by or utilizing MO2-plk1
Phenotype Fish Conditions Figures
tail bud apoptotic, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
mitotic cell cycle, embryonic disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
spinal cord apoptotic, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
integument fragile, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
cell centrosome position, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
chromosome condensation increased occurrence, abnormal WT + MO2-plk1 standard conditions Fig. 4 with image from Jeong et al., 2010
cell mitotic spindle disorganized, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
whole organism decreased size, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
mitotic centrosome separation disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
cell centrosome variability of size, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
median fin fold apoptotic, abnormal WT + MO2-plk1 standard conditions Fig. 2 with image from Jeong et al., 2010
mitotic sister chromatid separation disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 4 with image from Jeong et al., 2010
mitotic prometaphase arrested, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
mitotic metaphase chromosome alignment disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
mitotic spindle assembly disrupted, abnormal WT + MO2-plk1 standard conditions Fig. 3 with image from Jeong et al., 2010
mitotic cell cycle, embryonic disrupted, abnormal snu1Tg + MO2-plk1 standard conditions Fig. 5 with image from Jeong et al., 2010
mitotic sister chromatid separation disrupted, abnormal snu1Tg + MO2-plk1 standard conditions Fig. 5 with image from Jeong et al., 2010
mitotic metaphase chromosome alignment disrupted, abnormal snu1Tg + MO2-plk1 standard conditions Fig. 5 with image from Jeong et al., 2010
Citations