Morpholino

MO2-tbx1

ID
ZDB-MRPHLNO-100715-1
Name
MO2-tbx1
Previous Names
None
Target
Sequence
5' - ATTGGATTTACAATTTGCGCTGGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbx1
Expressed Gene Anatomy Figures
crestin Fig. 2 from Zhang et al., 2010
dlx2a Fig. 3 from Zhang et al., 2010
hand2 Fig. 2 from Zhang et al., 2010
myh7 Fig. 5 from Zhang et al., 2010
myl7 Fig. 5 from Zhang et al., 2010
nkx2.5 Fig. 5 from Zhang et al., 2010
rag1 Fig. 1 from Zhang et al., 2010
Phenotype
Phenotype resulting from MO2-tbx1
Phenotype Fish Figures
aortic arch decreased amount, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
atrium decreased size, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
blood circulation disrupted, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
cardiac ventricle decreased size, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
ceratobranchial cartilage aplastic, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
heart decreased contractility, abnormal AB + MO2-tbx1 Fig. 4 from Zhang et al., 2010
heart symmetry, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
heart contraction decreased rate, abnormal AB + MO2-tbx1 Fig. 4 from Zhang et al., 2010
heart development disrupted, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
heart looping disrupted, abnormal AB + MO2-tbx1 Fig. 5 from Zhang et al., 2010
hindbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
macula hypoplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
Meckel's cartilage decreased size, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
midbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
otic vesicle decreased size, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell present, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 neural crest cell absent, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 neural crest cell decreased amount, abnormal AB + MO2-tbx1 Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 skeleton decreased size, abnormal AB + MO2-tbx1 Fig. 2 from Zhang et al., 2010
pharyngeal arch 3-7 neural crest cell absent, abnormal AB + MO2-tbx1 Fig. 2,  Fig. 3 from Zhang et al., 2010
semicircular canal hypoplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
thymus aplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
thymus hypoplastic, abnormal AB + MO2-tbx1 Fig. 1 from Zhang et al., 2010
Phenotype of all Fish created by or utilizing MO2-tbx1
Phenotype Fish Conditions Figures
pharyngeal arch 2 neural crest cell absent, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
pharyngeal arch 3-7 neural crest cell absent, abnormal AB + MO2-tbx1 standard conditions Fig. 2,  Fig. 3 from Zhang et al., 2010
semicircular canal hypoplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
ceratobranchial cartilage aplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
hindbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
heart looping disrupted, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
heart decreased contractility, abnormal AB + MO2-tbx1 standard conditions Fig. 4 from Zhang et al., 2010
thymus aplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
heart symmetry, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
otic vesicle decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
blood circulation disrupted, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
pharyngeal arch 2 skeleton decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
cardiac ventricle decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
Meckel's cartilage decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
heart contraction decreased rate, abnormal AB + MO2-tbx1 standard conditions Fig. 4 from Zhang et al., 2010
midbrain neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 2 from Zhang et al., 2010
thymus hypoplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
atrium decreased size, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
macula hypoplastic, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
pharyngeal arch 1 neural crest cell present, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
pharyngeal arch 2 neural crest cell decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 3 from Zhang et al., 2010
heart development disrupted, abnormal AB + MO2-tbx1 standard conditions Fig. 5 from Zhang et al., 2010
aortic arch decreased amount, abnormal AB + MO2-tbx1 standard conditions Fig. 1 from Zhang et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.