Morpholino

MO1-pkd1b

ID
ZDB-MRPHLNO-100707-3
Name
MO1-pkd1b
Previous Names
  • pkd1b MO ex45 (1)
Target
Sequence
5' - ACATGATATTTGTACCTCTTTGGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pkd1b
Phenotype
Phenotype resulting from MO1-pkd1b
No data available
Phenotype of all Fish created by or utilizing MO1-pkd1b
Phenotype Fish Conditions Figures
whole organism curved dorsal, abnormal pkd1ahu5855/hu5855 + MO1-pkd1b standard conditions Fig. 2 with image from Coxam et al., 2014
vascular lymphangioblast cell migration process quality, abnormal pkd1ahu5855/hu5855 + MO1-pkd1b standard conditions Fig. S2 with image from Coxam et al., 2014
thoracic duct malformed, abnormal pkd1ahu5855/hu5855 + MO1-pkd1b standard conditions Fig. S3 with image from Coxam et al., 2014
notochord undulate, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 4 from Mangos et al., 2010
regulation of collagen biosynthetic process process quality, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 4 from Mangos et al., 2010
endochondral ossification delayed, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
mandibular arch skeleton morphology, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton bone mineralization decreased occurrence, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
post-vent region curved dorsal, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 with image from Merrick et al., 2012
Fig. 2Fig. 3Fig. 5 from Mangos et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
whole organism curved dorsal, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. S4 with image from Coxam et al., 2014
post-vent region curved, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
brain hydrocephalic, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
mandibular arch skeleton malformed, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
post-vent region curved, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton morphology, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton bone mineralization decreased occurrence, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
thoracic duct malformed, abnormal WT + MO1-pkd1b + MO2-col2a1a + MO2-pkd1a standard conditions Fig. S4 with image from Coxam et al., 2014
post-vent region curved dorsal, abnormal WT + MO1-pkd1b + MO2-pkd1a + MO7-pkd2 standard conditions Fig. 3 from Mangos et al., 2010
Meckel's cartilage decreased length, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
Meckel's cartilage chondrocyte circular, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
mandibular arch skeleton malformed, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
thoracic duct malformed, abnormal pkd1ahu5855/hu5855; hu5333Tg; y1Tg + MO1-pkd1b standard conditions Fig. 2 with image from Coxam et al., 2014
thoracic duct absent, abnormal pkd1ahu5855/hu5855; hu5333Tg; y1Tg + MO1-pkd1b standard conditions Fig. 2 with image from Coxam et al., 2014
Citations