Morpholino

MO2-pkd1a

ID
ZDB-MRPHLNO-100707-2
Name
MO2-pkd1a
Previous Names
  • pkd1a MO ex8 (1)
Target
Sequence
5' - GATCTGAGGACTCACTGTGTGATTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pkd1a
No data available
Phenotype
Phenotype resulting from MO2-pkd1a
No data available
Phenotype of all Fish created by or utilizing MO2-pkd1a
Phenotype Fish Conditions Figures
whole organism curved dorsal, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. S4 with image from Coxam et al., 2014
notochord undulate, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 4 from Mangos et al., 2010
regulation of collagen biosynthetic process process quality, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 4 from Mangos et al., 2010
endochondral ossification delayed, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
post-vent region curved, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
brain hydrocephalic, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
mandibular arch skeleton morphology, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton bone mineralization decreased occurrence, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
post-vent region curved dorsal, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 7 with image from Merrick et al., 2012
Fig. 2Fig. 3Fig. 5 from Mangos et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
mandibular arch skeleton malformed, abnormal WT + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
post-vent region curved, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton morphology, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
mandibular arch skeleton bone mineralization decreased occurrence, abnormal WT + MO1-pkd1b + MO1-wwtr1 + MO2-pkd1a standard conditions Fig. 7 from Merrick et al., 2018
thoracic duct malformed, abnormal WT + MO1-pkd1b + MO2-col2a1a + MO2-pkd1a standard conditions Fig. S4 with image from Coxam et al., 2014
post-vent region curved dorsal, abnormal WT + MO1-pkd1b + MO2-pkd1a + MO7-pkd2 standard conditions Fig. 3 from Mangos et al., 2010
Meckel's cartilage decreased length, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
Meckel's cartilage chondrocyte circular, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
mandibular arch skeleton malformed, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal zf195Tg + MO1-pkd1b + MO2-pkd1a standard conditions Fig. 2 from Mangos et al., 2010
Citations