Morpholino

MO2-nphp3

ID

ZDB-MRPHLNO-100629-4

Name

MO2-nphp3

Previous Names

Target

Sequence

5' - GCCGTGTGTGTACCTGAATGAAAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-nphp3

Expressed Gene	Anatomy	Figures
foxa3	liver pancreas	Fig. 3 from Zhou et al., 2010

Phenotype

Phenotype resulting from MO2-nphp3

Phenotype	Fish	Figures
atrium mislocalised, abnormal	WT + MO2-nphp3	Fig. 3 from Zhou et al., 2010
cardiac ventricle mislocalised, abnormal	WT + MO2-nphp3	Fig. 3 from Zhou et al., 2010
fourth ventricle hydrocephalic, abnormal	WT + MO2-nphp3	Fig. 2 from Zhou et al., 2010
heart centered, abnormal	li1Tg + MO2-nphp3	Fig. 1 from Hoff et al., 2013
heart jogging disrupted, abnormal	WT + MO2-nphp3	Fig. 3 from Zhou et al., 2010
heart looping disrupted, abnormal	li1Tg + MO2-nphp3	Fig. 1 from Hoff et al., 2013
pronephros cystic, abnormal	li1Tg + MO2-nphp3	Fig. 1 from Hoff et al., 2013
trunk curved ventral, abnormal	li1Tg + MO2-nphp3	Fig. 1 from Hoff et al., 2013
whole organism curved ventral, abnormal	WT + MO2-nphp3	Fig. 2 from Zhou et al., 2010

Phenotype of all Fish created by or utilizing MO2-nphp3

Phenotype	Fish	Conditions	Figures
heart jogging disrupted, abnormal	WT + MO2-nphp3	standard conditions	Fig. 3 from Zhou et al., 2010
atrium mislocalised, abnormal	WT + MO2-nphp3	standard conditions	Fig. 3 from Zhou et al., 2010
fourth ventricle hydrocephalic, abnormal	WT + MO2-nphp3	standard conditions	Fig. 2 from Zhou et al., 2010
whole organism curved ventral, abnormal	WT + MO2-nphp3	standard conditions	Fig. 2 from Zhou et al., 2010
cardiac ventricle mislocalised, abnormal	WT + MO2-nphp3	standard conditions	Fig. 3 from Zhou et al., 2010
trunk curved ventral, abnormal	li1Tg + MO2-nphp3	standard conditions	Fig. 1 from Hoff et al., 2013
heart looping disrupted, abnormal	li1Tg + MO2-nphp3	standard conditions	Fig. 1 from Hoff et al., 2013
pronephros cystic, abnormal	li1Tg + MO2-nphp3	standard conditions	Fig. 1 from Hoff et al., 2013
heart centered, abnormal	li1Tg + MO2-nphp3	standard conditions	Fig. 1 from Hoff et al., 2013
pronephros cystic, abnormal	li1Tg + MO1-anks6 + MO2-nphp3	standard conditions	Fig. S2 from Hoff et al., 2013

Citations