Morpholino
MO2-nphp3
- ID
- ZDB-MRPHLNO-100629-4
- Name
- MO2-nphp3
- Previous Names
-
- SP MO (1)
- MO2-si:dkey-56l10.1
- Target
- Sequence
-
5' - GCCGTGTGTGTACCTGAATGAAAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nphp3
Expressed Gene | Anatomy | Figures |
---|---|---|
foxa3 |
Fig. 3
from Zhou et al., 2010 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO2-nphp3
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO2-nphp3
1 - 5 of 10 Show all
Citations
- Hoff, S., Halbritter, J., Epting, D., Frank, V., Nguyen, T.M., van Reeuwijk, J., Boehlke, C., Schell, C., Yasunaga, T., Helmstädter, M., Mergen, M., Filhol, E., Boldt, K., Horn, N., Ueffing, M., Otto, E.A., Eisenberger, T., Elting, M.W., van Wijk, J.A., Bockenhauer, D., Sebire, N.J., Rittig, S., Vyberg, M., Ring, T., Pohl, M., Pape, L., Neuhaus, T.J., Elshakhs, N.A., Koon, S.J., Harris, P.C., Grahammer, F., Huber, T.B., Kuehn, E.W., Kramer-Zucker, A., Bolz, H.J., Roepman, R., Saunier, S., Walz, G., Hildebrandt, F., Bergmann, C., and Lienkamp, S.S. (2013) ANKS6 is a central component of a nephronophthisis module linking NEK8 to INVS and NPHP3. Nature Genetics. 45(8):951-6
- Zhou, W., Dai, J., Attanasio, M., and Hildebrandt, F. (2010) Nephrocystin-3 is required for ciliary function in zebrafish embryos. American journal of physiology. Renal physiology. 299(1):F55-F62
1 - 2 of 2
Show