Morpholino

MO1-nphp3

ID
ZDB-MRPHLNO-100629-2
Name
MO1-nphp3
Previous Names
  • AUG MO (1)
  • MO1-si:dkey-56l10.1
Target
Sequence
5' - TGCCGTACCCATAACAACTGATAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphp3
Expressed Gene Anatomy Figures
lft1 Fig. 3 from Zhou et al., 2010
lft2 Fig. 3 from Zhou et al., 2010
myl7 Fig. 3 from Zhou et al., 2010
spaw Fig. 3 from Zhou et al., 2010
Phenotype
Phenotype resulting from MO1-nphp3
Phenotype Fish Figures
atrium mislocalised, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
cardiac ventricle mislocalised, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
convergent extension involved in somitogenesis disrupted, abnormal WT + MO1-nphp3 Fig. 6 from Zhou et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
fourth ventricle hydrocephalic, abnormal WT + MO1-nphp3 Fig. 2 from Zhou et al., 2010
heart jogging disrupted, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-nphp3 Fig. 4 from Zhou et al., 2010
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-nphp3 Fig. 4 from Zhou et al., 2010
liver mislocalised, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
pancreas mislocalised, abnormal WT + MO1-nphp3 Fig. 3 from Zhou et al., 2010
pronephros cystic, abnormal WT + MO1-nphp3 Fig. 2 from Zhou et al., 2010
whole organism curved ventral, abnormal WT + MO1-nphp3 Fig. 2 from Zhou et al., 2010
whole organism decreased length, abnormal WT + MO1-nphp3 Fig. 6 from Zhou et al., 2010
Phenotype of all Fish created by or utilizing MO1-nphp3
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-nphp3 standard conditions Fig. 4 from Zhou et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-nphp3 standard conditions Fig. 4 from Zhou et al., 2010
atrium mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
whole organism curved ventral, abnormal WT + MO1-nphp3 standard conditions Fig. 2 from Zhou et al., 2010
whole organism decreased length, abnormal WT + MO1-nphp3 standard conditions Fig. 6 from Zhou et al., 2010
heart jogging disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
fourth ventricle hydrocephalic, abnormal WT + MO1-nphp3 standard conditions Fig. 2 from Zhou et al., 2010
pronephros cystic, abnormal WT + MO1-nphp3 standard conditions Fig. 2 from Zhou et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
liver mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
cardiac ventricle mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
convergent extension involved in somitogenesis disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 6 from Zhou et al., 2010
pancreas mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
liver development disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
liver mislocalised, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
pancreas mislocalised, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.