Morpholino

MO1-septin9a

ID

ZDB-MRPHLNO-100624-8

Name

MO1-septin9a

Previous Names

Target

Sequence

5' - TGCGATGCCTGTCAGCACAGAAGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-septin9a

No data available

Phenotype

Phenotype resulting from MO1-septin9a

Phenotype	Fish	Figures
blood lacks parts or has fewer parts of type nucleate erythrocyte, abnormal	WT + MO1-septin9a	text only from Landsverk et al., 2010
blood circulation disrupted, abnormal	WT + MO1-septin9a	text only from Landsverk et al., 2010
epidermis aggregated, abnormal	WT + MO1-septin9a	Fig. 4 from Landsverk et al., 2010
extension structure, abnormal	WT + MO1-septin9a	Fig. 4 from Landsverk et al., 2010
intermediate cell mass of mesoderm increased accumulation blood, abnormal	WT + MO1-septin9a	text only from Landsverk et al., 2010
pericardium edematous, abnormal	WT + MO1-septin9a	Fig. 4 from Landsverk et al., 2010
post-vent region apoptotic, abnormal	WT + MO1-septin9a	Fig. 5 from Landsverk et al., 2010
post-vent region edematous, abnormal	WT + MO1-septin9a	Fig. 4 from Landsverk et al., 2010
post-vent region increased accumulation blood, abnormal	WT + MO1-septin9a	text only from Landsverk et al., 2010
whole organism decreased length, abnormal	WT + MO1-septin9a	Fig. 4 from Landsverk et al., 2010
whole organism increased curvature, abnormal	WT + MO1-septin9a	Fig. 4 from Landsverk et al., 2010
whole organism viability, abnormal	WT + MO1-septin9a	text only from Landsverk et al., 2010

Phenotype of all Fish created by or utilizing MO1-septin9a

Phenotype	Fish	Conditions	Figures
extension structure, abnormal	WT + MO1-septin9a	standard conditions	Fig. 4 from Landsverk et al., 2010
blood lacks parts or has fewer parts of type nucleate erythrocyte, abnormal	WT + MO1-septin9a	standard conditions	text only from Landsverk et al., 2010
whole organism viability, abnormal	WT + MO1-septin9a	standard conditions	text only from Landsverk et al., 2010
intermediate cell mass of mesoderm increased accumulation blood, abnormal	WT + MO1-septin9a	standard conditions	text only from Landsverk et al., 2010
post-vent region increased accumulation blood, abnormal	WT + MO1-septin9a	standard conditions	text only from Landsverk et al., 2010
post-vent region apoptotic, abnormal	WT + MO1-septin9a	standard conditions	Fig. 5 from Landsverk et al., 2010
whole organism decreased length, abnormal	WT + MO1-septin9a	standard conditions	Fig. 4 from Landsverk et al., 2010
epidermis aggregated, abnormal	WT + MO1-septin9a	standard conditions	Fig. 4 from Landsverk et al., 2010
whole organism increased curvature, abnormal	WT + MO1-septin9a	standard conditions	Fig. 4 from Landsverk et al., 2010
post-vent region edematous, abnormal	WT + MO1-septin9a	standard conditions	Fig. 4 from Landsverk et al., 2010
pericardium edematous, abnormal	WT + MO1-septin9a	standard conditions	Fig. 4 from Landsverk et al., 2010
blood circulation disrupted, abnormal	WT + MO1-septin9a	standard conditions	text only from Landsverk et al., 2010

Citations