Morpholino
MO2-esr1
- ID
- ZDB-MRPHLNO-100624-3
- Name
- MO2-esr1
- Previous Names
- None
- Target
- Sequence
-
5' - AGGAAGGTTCCTCCAGGGCTTCTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-esr1
Expressed Gene | Anatomy | Figures |
---|---|---|
comtb |
Fig. 7
from Bertotto et al., 2018 |
|
drd1b |
Fig. 6
from Bertotto et al., 2018 |
|
mao |
Fig. 7
from Bertotto et al., 2018 |
|
runx1 |
Fig. 2 ![]() |
|
vtg1 |
Fig. 5
from Bertotto et al., 2018 |
Phenotype
Phenotype resulting from MO2-esr1
Phenotype of all Fish created by or utilizing MO2-esr1
Citations
- Chaturantabut, S., Shwartz, A., Garnaas, M.K., LaBella, K., Li, C.C., Carroll, K.J., Cutting, C.C., Budrow, N., Palaria, A., Gorelick, D.A., Tremblay, K.D., North, T.E., Goessling, W. (2020) Estrogen acts via estrogen receptor 2b to regulate hepatobiliary fate during vertebrate development. Hepatology (Baltimore, Md.). 72(5):1786-1799
- Chaturantabut, S., Shwartz, A., Evason, K.J., Cox, A.G., Labella, K., Schepers, A.G., Yang, S., Aravena, M., Houvras, Y., Mancio-Silva, L., Romano, S., Gorelick, D.A., Cohen, D.E., Zon, L.I., Bhatia, S.N., North, T.E., Goessling, W. (2019) Estrogen Activation of G protein-coupled Estrogen Receptor 1 Regulates Phosphoinositide 3-kinase and mTOR Signaling to Promote Liver Growth in Zebrafish and Proliferation of Human Hepatocytes. Gastroenterology. 156(6):1788-1804.e13
- Bertotto, L.B., Dasgupta, S., Vliet, S., Dudley, S., Gan, J., Volz, D.C., Schlenk, D. (2018) Evaluation of the estrogen receptor alpha as a possible target of bifenthrin effects in the estrogenic and dopaminergic signaling pathways in zebrafish embryos. The Science of the total environment. 651:2424-2431
- Moreman, J., Takesono, A., Trznadel, M., Winter, M., Perry, A., Wood, M., Rogers, N.J., Kudoh, T., Tyler, C.R. (2018) Estrogenic mechanisms and cardiac responses following early life exposure to Bisphenol A (BPA) and its metabolite 4-methyl-2,4-bis(p-hydroxyphenyl)pent-1-ene (MBP) in zebrafish. Environmental science & technology. 52(11):6656-6665
- Carroll, K.J., Esain, V., Garnaas, M.K., Cortes, M., Dovey, M.C., Nissim, S., Frechette, G.M., Liu, S.Y., Kwan, W., Cutting, C.C., Harris, J.M., Gorelick, D.A., Halpern, M.E., Lawson, N.D., Goessling, W., North, T.E. (2014) Estrogen defines the dorsal-ventral limit of VEGF regulation to specify the location of the hemogenic endothelial niche. Developmental Cell. 29:437-53
- Pang, Y., and Thomas, P. (2010) Role of G protein-coupled estrogen receptor 1, GPER, in inhibition of oocyte maturation by endogenous estrogens in zebrafish. Developmental Biology. 342(2):194-206
1 - 6 of 6
Show