Morpholino
MO2-col2a1a
- ID
- ZDB-MRPHLNO-100616-4
- Name
- MO2-col2a1a
- Previous Names
-
- col2a1a MO ex1 (1)
- Target
- Sequence
-
5' - TGAAAAACTCCAACTTACGGTCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-col2a1a
No data available
Phenotype
Phenotype resulting from MO2-col2a1a
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-col2a1a
1 - 5 of 9 Show all
Citations
- Flanagan-Steet, H., Aarnio, M., Kwan, B., Guihard, P., Petrey, A., Haskins, M., Blanchard, F., Steet, R. (2016) Cathepsin-Mediated Alterations In TGFß-Related Signaling Underlie Disrupted Cartilage and Bone Maturation Associated With Impaired Lysosomal Targeting. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 31(3):535-48
- Coxam, B., Sabine, A., Bower, N.I., Smith, K.A., Pichol-Thievend, C., Skoczylas, R., Astin, J.W., Frampton, E., Jaquet, M., Crosier, P.S., Parton, R.G., Harvey, N.L., Petrova, T.V., Schulte-Merker, S., Francois, M., Hogan, B.M. (2014) Pkd1 Regulates Lymphatic Vascular Morphogenesis during Development. Cell Reports. 7:623-33
- Le Corre, S., Eyre, D., Drummond, I.A. (2014) Modulation of the Secretory Pathway Rescues Zebrafish Polycystic Kidney Disease Pathology. Journal of the American Society of Nephrology : JASN. 25(8):1749-59
- Corallo, D., Schiavinato, A., Trapani, V., Moro, E., Argenton, F., and Bonaldo, P. (2013) Emilin3 is required for notochord sheath integrity and interacts with Scube2 to regulate notochord-derived Hedgehog signals. Development (Cambridge, England). 140(22):4594-4601
- Mangos, S., Lam, P.Y., Zhao, A., Liu, Y., Mudumana, S., Vasilyev, A., Liu, A., and Drummond, I.A. (2010) The ADPKD genes pkd1a/b and pkd2 regulate extracellular matrix formation. Disease models & mechanisms. 3(5-6):354-365
1 - 5 of 5
Show