ZFIN ID: ZDB-MRPHLNO-100610-6
Morpholino Name: MO7-pax6b
Target: pax6b (1)
Previous Name: MO4Pax6b (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCAACCGTCTGCAAAAATATAACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO7-pax6b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO7-pax6b No data available
PHENOTYPE
Phenotype resulting from MO7-pax6b
No data available

Phenotype of all Fish created by or utilizing MO7-pax6b
Genome Resources:
CITATIONS (1)