Morpholino

MO1-piwil2

ID
ZDB-MRPHLNO-100524-3
Name
MO1-piwil2
Previous Names
  • zili-MO1 (1)
Target
Sequence
5' - GATCCATTTCTTCCTCTGTTGCACT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-piwil2
No data available
Phenotype
Phenotype resulting from MO1-piwil2
Phenotype Fish Figures
blastomere bmp2b expression increased amount, abnormal AB + MO1-piwil2 Fig. 2 from Li et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
forerunner cell group nog1 expression decreased amount, abnormal AB + MO1-piwil2 Fig. 2 from Li et al., 2011
forerunner cell group fsta expression decreased amount, abnormal AB + MO1-piwil2 Fig. 2 from Li et al., 2011
forerunner cell group chrd expression decreased amount, abnormal AB + MO1-piwil2 Fig. 2 from Li et al., 2011
margin tbxta expression decreased amount, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
mesoderm snai1a expression decreased distribution, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
noninvoluting endocytic marginal cell cluster chrd expression decreased amount, abnormal AB + MO1-piwil2 Fig. 2 from Li et al., 2011
notochord shha expression decreased amount, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
positive regulation of gene expression disrupted, abnormal WT + MO1-piwil2 Fig. 1 from Zhao et al., 2010
post-vent region decreased length, abnormal WT + MO1-piwil2 Fig. 2 with image from Sun et al., 2010
presumptive ventral mesoderm vox expression increased amount, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
presumptive ventral mesoderm tbx6 expression increased amount, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
presumptive ventral mesoderm vent expression increased amount, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
presumptive ventral mesoderm vent expression increased distribution, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
presumptive ventral mesoderm tbx6 expression increased distribution, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
presumptive ventral mesoderm vox expression increased distribution, abnormal AB + MO1-piwil2 Fig. 1 from Li et al., 2011
regulation of BMP signaling pathway process quality, abnormal AB + MO1-piwil2 Fig. 2 from Li et al., 2011
ventral fin fold aplastic, abnormal WT + MO1-piwil2 Fig. 2 with image from Sun et al., 2010
whole organism bmp4 expression increased distribution, abnormal AB + MO1-piwil2 Fig. 2 from Li et al., 2011
whole organism wholly dorsalized, abnormal WT + MO1-piwil2 Fig. 2 with image from Sun et al., 2010
Phenotype of all Fish created by or utilizing MO1-piwil2
Phenotype Fish Conditions Figures
presumptive ventral mesoderm vox expression increased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
presumptive ventral mesoderm tbx6 expression increased distribution, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
noninvoluting endocytic marginal cell cluster chrd expression decreased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 2 from Li et al., 2011
presumptive ventral mesoderm vent expression increased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
margin tbxta expression decreased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
whole organism bmp4 expression increased distribution, abnormal AB + MO1-piwil2 standard conditions Fig. 2 from Li et al., 2011
presumptive ventral mesoderm tbx6 expression increased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
presumptive ventral mesoderm vent expression increased distribution, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
forerunner cell group chrd expression decreased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 2 from Li et al., 2011
presumptive ventral mesoderm vox expression increased distribution, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
forerunner cell group fsta expression decreased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 2 from Li et al., 2011
mesoderm snai1a expression decreased distribution, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
blastomere bmp2b expression increased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 2 from Li et al., 2011
notochord shha expression decreased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 1 from Li et al., 2011
forerunner cell group nog1 expression decreased amount, abnormal AB + MO1-piwil2 standard conditions Fig. 2 from Li et al., 2011
regulation of BMP signaling pathway process quality, abnormal AB + MO1-piwil2 standard conditions Fig. 2 from Li et al., 2011
ventral fin fold aplastic, abnormal WT + MO1-piwil2 standard conditions Fig. 2 with image from Sun et al., 2010
whole organism wholly dorsalized, abnormal WT + MO1-piwil2 standard conditions Fig. 2 with image from Sun et al., 2010
positive regulation of gene expression disrupted, abnormal WT + MO1-piwil2 standard conditions Fig. 1 from Zhao et al., 2010
post-vent region decreased length, abnormal WT + MO1-piwil2 standard conditions Fig. 2 with image from Sun et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.