Morpholino

MO1-clint1a

ID
ZDB-MRPHLNO-100510-11
Name
MO1-clint1a
Previous Names
  • clint1-atg MO (1)
  • MO1-clint1
Target
Sequence
5' - CCGCACTTTCCACATATTCAACATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 14
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-clint1a
No data available
Phenotype
Phenotype resulting from MO1-clint1a
Phenotype Fish Figures
epidermis cell population proliferation increased occurrence, abnormal zf106Tg + MO1-clint1a Fig. 3,  Fig. 6 from Phatak et al., 2018
head epidermal cell morphology, abnormal WT + MO1-clint1a Fig. 1,  Fig. 7 from Phatak et al., 2018
peridermal cell decreased size, abnormal zf106Tg + MO1-clint1a Fig. 3,  Fig. 5 from Phatak et al., 2018
peridermal cell cell population proliferation increased occurrence, abnormal zf106Tg + MO1-clint1a Fig. 3,  Fig. 6 from Phatak et al., 2018
peridermal cell endocytosis increased occurrence, abnormal zf106Tg + MO1-clint1a Fig. 2,  Fig. 4 from Phatak et al., 2018
peridermal cell lysosome increased amount, abnormal zf106Tg + MO1-clint1a Fig. 2 from Phatak et al., 2018
peridermal cell perinucleolar compartment ab1-cav1 labeling increased amount, abnormal zf106Tg + MO1-clint1a Fig. 2 from Phatak et al., 2018
peridermal cell perinucleolar compartment EGFP expression increased amount, abnormal zf106Tg + MO1-clint1a Fig. 1,  Fig. 2 from Phatak et al., 2018
trunk epidermal cell morphology, abnormal zf106Tg + MO1-clint1a Fig. 1,  Fig. 7 from Phatak et al., 2018
Phenotype of all Fish created by or utilizing MO1-clint1a
Phenotype Fish Conditions Figures
head epidermal cell morphology, abnormal WT + MO1-clint1a standard conditions Fig. 1 from Phatak et al., 2018
trunk epidermal cell morphology, abnormal WT + MO1-clint1a standard conditions Fig. 1 from Phatak et al., 2018
peridermal cell decreased size, abnormal zf106Tg + MO1-clint1a standard conditions Fig. 3,  Fig. 5 from Phatak et al., 2018
epidermis cell population proliferation occurrence, ameliorated zf106Tg + MO1-clint1a chemical treatment: dynasore Fig. 6 from Phatak et al., 2018
peridermal cell cell population proliferation increased occurrence, abnormal zf106Tg + MO1-clint1a standard conditions Fig. 3,  Fig. 6 from Phatak et al., 2018
peridermal cell perinucleolar compartment ab1-cav1 labeling increased amount, abnormal zf106Tg + MO1-clint1a standard conditions Fig. 2 from Phatak et al., 2018
peridermal cell cell population proliferation occurrence, ameliorated zf106Tg + MO1-clint1a chemical treatment: dynasore Fig. 6 from Phatak et al., 2018
peridermal cell lysosome increased amount, abnormal zf106Tg + MO1-clint1a standard conditions Fig. 2 from Phatak et al., 2018
head epidermal cell morphology, ameliorated zf106Tg + MO1-clint1a chemical treatment: dynasore Fig. 7 from Phatak et al., 2018
trunk epidermal cell morphology, ameliorated zf106Tg + MO1-clint1a chemical treatment: dynasore Fig. 7 from Phatak et al., 2018
peridermal cell perinucleolar compartment EGFP expression increased amount, abnormal zf106Tg + MO1-clint1a standard conditions Fig. 1,  Fig. 2 from Phatak et al., 2018
peridermal cell size, ameliorated zf106Tg + MO1-clint1a chemical treatment: dynasore Fig. 5 from Phatak et al., 2018
peridermal cell endocytosis occurrence, ameliorated zf106Tg + MO1-clint1a chemical treatment: dynasore Fig. 4 from Phatak et al., 2018
peridermal cell endocytosis increased occurrence, abnormal zf106Tg + MO1-clint1a control Fig. 2,  Fig. 4 from Phatak et al., 2018
epidermis cell population proliferation increased occurrence, abnormal zf106Tg + MO1-clint1a standard conditions Fig. 3,  Fig. 6 from Phatak et al., 2018
trunk epidermal cell morphology, abnormal zf106Tg + MO1-clint1a control Fig. 7 from Phatak et al., 2018
head epidermal cell morphology, abnormal zf106Tg + MO1-clint1a control Fig. 7 from Phatak et al., 2018
Citations
TSV
1 - 2 of 2
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.