Morpholino
MO1-tardbpa
- ID
- ZDB-MRPHLNO-100506-2
- Name
- MO1-tardbpa
- Previous Names
-
- MO1-tardbpl
- Target
- Sequence
-
5' - CCACACGAATATAGCACTCCGTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tardbpa
No data available
Phenotype
Phenotype resulting from MO1-tardbpa
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-tardbpa
1 - 5 of 24 Show all
Citations
- Dzieciolowska, S., Drapeau, P., Armstrong, G.A.B. (2017) Augmented quantal release of acetylcholine at the vertebrate neuromuscular junction following tdp-43 depletion. PLoS One. 12:e0177005
- Hewamadduma, C.A., Grierson, A.J., Ma, T.P., Pan, L., Moens, C.B., Ingham, P.W., Ramesh, T., and Shaw, P.J. (2013) Tardbpl splicing rescues motor neuron and axonal development in a mutant tardbp zebrafish. Human molecular genetics. 22(12):2376-86
- Kabashi, E., Lin, L., Tradewell, M.L., Dion, P.A., Bercier, V., Bourgouin, P., Rochefort, D., Bel Hadj, S., Durham, H.D., Vande Velde, C., Rouleau, G.A., and Drapeau, P. (2010) Gain and loss of function of ALS-related mutations of TARDBP (TDP-43) cause motor deficits in vivo. Human molecular genetics. 19(4):671-683
1 - 3 of 3
Show