header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100430-4
Morpholino Name: MO4-cebp1
Target: cebp1 (1)
Sequence:
5' - GGAGCTGCTGAACTCTACTCGATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-cebp1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-cebp1 No data available
PHENOTYPE
Phenotype resulting from MO4-cebp1
No data available

Phenotype of all Fish created by or utilizing MO4-cebp1
No data available
OTHER MO4-cebp1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)