Morpholino

MO2-gbx1

ID

ZDB-MRPHLNO-100429-4

Name

MO2-gbx1

Previous Names

Target

Sequence

5' - CGCTGCTGAAGGGTCCTCGCCGTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-gbx1

Expressed Gene	Anatomy	Figures
egr2b	(not) presumptive rhombomere 3 (not) presumptive rhombomere 5	Fig. 5 from Rhinn et al., 2009
myod1	segmental plate somite	Fig. 5 from Rhinn et al., 2009
otx2b	forebrain neural keel midbrain neural keel	Fig. 5 from Rhinn et al., 2009

Phenotype

Phenotype resulting from MO2-gbx1

Phenotype	Fish	Figures
brain morphology, abnormal	WT + MO2-gbx1	Fig. S1 from Rhinn et al., 2009
gastrulation delayed, abnormal	WT + MO2-gbx1	Fig. S1 from Rhinn et al., 2009
hindbrain anterior region decreased size, abnormal	WT + MO2-gbx1	Fig. 5 from Rhinn et al., 2009
hindbrain anterior-posterior axis decreased length, abnormal	WT + MO2-gbx1	Fig. S1 from Rhinn et al., 2009
midbrain hindbrain boundary neural keel morphology, abnormal	WT + MO2-gbx1	Fig. S1 from Rhinn et al., 2009
neural keel wholly anteriorized, abnormal	WT + MO2-gbx1	Fig. 5 from Rhinn et al., 2009
spinal cord decreased length, abnormal	WT + MO2-gbx1	Fig. S1 from Rhinn et al., 2009
spinal cord neural keel decreased length, abnormal	WT + MO2-gbx1	Fig. 5 from Rhinn et al., 2009
whole organism necrotic, abnormal	WT + MO2-gbx1	Fig. S1 from Rhinn et al., 2009
whole organism shape, abnormal	WT + MO2-gbx1	Fig. S1 from Rhinn et al., 2009

Phenotype of all Fish created by or utilizing MO2-gbx1

Phenotype	Fish	Conditions	Figures
whole organism necrotic, abnormal	WT + MO2-gbx1	standard conditions	Fig. S1 from Rhinn et al., 2009
hindbrain anterior-posterior axis decreased length, abnormal	WT + MO2-gbx1	standard conditions	Fig. S1 from Rhinn et al., 2009
midbrain hindbrain boundary neural keel morphology, abnormal	WT + MO2-gbx1	standard conditions	Fig. S1 from Rhinn et al., 2009
brain morphology, abnormal	WT + MO2-gbx1	standard conditions	Fig. S1 from Rhinn et al., 2009
gastrulation delayed, abnormal	WT + MO2-gbx1	standard conditions	Fig. S1 from Rhinn et al., 2009
whole organism shape, abnormal	WT + MO2-gbx1	standard conditions	Fig. S1 from Rhinn et al., 2009
spinal cord neural keel decreased length, abnormal	WT + MO2-gbx1	standard conditions	Fig. 5 from Rhinn et al., 2009
hindbrain anterior region decreased size, abnormal	WT + MO2-gbx1	standard conditions	Fig. 5 from Rhinn et al., 2009
neural keel wholly anteriorized, abnormal	WT + MO2-gbx1	standard conditions	Fig. 5 from Rhinn et al., 2009
spinal cord decreased length, abnormal	WT + MO2-gbx1	standard conditions	Fig. S1 from Rhinn et al., 2009

Citations