Morpholino

MO1-pou3f2b

ID

ZDB-MRPHLNO-100423-9

Name

MO1-pou3f2b

Previous Names

Target

Sequence

5' - ATGATTGGATGCTGTAGTCGCCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

translation-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pou3f2b

Expressed Gene	Anatomy	Figures
fli1	intersegmental vessel trunk vasculature	Fig. 4 from Wong et al., 2017
kdr	intersegmental vessel trunk vasculature	Fig. 4 from Wong et al., 2017

Phenotype

Phenotype resulting from MO1-pou3f2b

Phenotype	Fish	Figures
caudal fin curled, abnormal	WIK + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
endothelial cell decreased amount, abnormal	y1Tg + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
intersegmental vessel kdr expression decreased amount, abnormal	WIK + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
intersegmental vessel fli1 expression decreased amount, abnormal	WIK + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
trunk vasculature fli1 expression decreased amount, abnormal	WIK + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
trunk vasculature kdr expression decreased amount, abnormal	WIK + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
trunk vasculature morphology, abnormal	y1Tg + MO1-pou3f2b	Fig. 4 from Wong et al., 2017
whole organism curved, abnormal	WIK + MO1-pou3f2b	Fig. 4 from Wong et al., 2017

Phenotype of all Fish created by or utilizing MO1-pou3f2b

Phenotype	Fish	Conditions	Figures
trunk vasculature kdr expression decreased amount, abnormal	WIK + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
intersegmental vessel fli1 expression decreased amount, abnormal	WIK + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
whole organism curved, abnormal	WIK + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
trunk vasculature fli1 expression decreased amount, abnormal	WIK + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
caudal fin curled, abnormal	WIK + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
intersegmental vessel kdr expression decreased amount, abnormal	WIK + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
endothelial cell decreased amount, abnormal	y1Tg + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
trunk vasculature morphology, abnormal	y1Tg + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-pou3f2b	standard conditions	Fig. 4 from Wong et al., 2017

Citations