Morpholino

MO2-rpgrb

ID

ZDB-MRPHLNO-100413-2

Name

MO2-rpgrb

Previous Names

None

Target

Sequence

5' - TTTCATCTTCTGTTTCTCCAGCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-rpgrb

No data available

Phenotype

Phenotype resulting from MO2-rpgrb

Phenotype	Fish	Figures
brain apoptotic, abnormal	AB + MO2-rpgrb	Fig. 5 from Shu et al., 2010
embryonic camera-type eye development disrupted, abnormal	AB + MO2-rpgrb	Fig. 3 from Shu et al., 2010
eye decreased size, abnormal	AB + MO2-rpgrb	Fig. 3 from Shu et al., 2010
head decreased size, abnormal	AB + MO2-rpgrb	Fig. 3 from Shu et al., 2010
post-vent region decreased length, abnormal	AB + MO2-rpgrb	Fig. 3 from Shu et al., 2010
post-vent region increased curvature, abnormal	AB + MO2-rpgrb	Fig. 3 from Shu et al., 2010
retina apoptotic, abnormal	AB + MO2-rpgrb	Fig. 5 from Shu et al., 2010
retina layer formation disrupted, abnormal	AB + MO2-rpgrb	Fig. 4 from Shu et al., 2010
retinal cone cell absent, abnormal	AB + MO2-rpgrb	Fig. 4 from Shu et al., 2010
retinal rod cell photoreceptor outer segment absent, abnormal	AB + MO2-rpgrb	Fig. 4, Fig. S5 from Shu et al., 2010

Phenotype of all Fish created by or utilizing MO2-rpgrb

Phenotype	Fish	Conditions	Figures
embryonic camera-type eye development disrupted, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 3 from Shu et al., 2010
retinal rod cell photoreceptor outer segment absent, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 4, Fig. S5 from Shu et al., 2010
eye decreased size, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 3 from Shu et al., 2010
post-vent region increased curvature, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 3 from Shu et al., 2010
brain apoptotic, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 5 from Shu et al., 2010
retina apoptotic, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 5 from Shu et al., 2010
pigment granule aggregation in cell center delayed, abnormal	AB + MO2-rpgrb	chemical treatment: (R)-adrenaline	Fig. 6 from Shu et al., 2010
head decreased size, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 3 from Shu et al., 2010
retina layer formation disrupted, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 4 from Shu et al., 2010
retinal cone cell absent, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 4 from Shu et al., 2010
post-vent region decreased length, abnormal	AB + MO2-rpgrb	standard conditions	Fig. 3 from Shu et al., 2010

Citations