Morpholino
MO3-mtm1
- ID
- ZDB-MRPHLNO-100325-3
- Name
- MO3-mtm1
- Previous Names
-
- Ex3 MO (1)
- Target
- Sequence
-
5' - CCTGTCAACACACGCAGGAACATTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mtm1
No data available
Phenotype
Phenotype resulting from MO3-mtm1
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO3-mtm1
1 - 5 of 26 Show all
Citations
- Sabha, N., Volpatti, J.R., Gonorazky, H., Reifler, A., Davidson, A.E., Li, X., Eltayeb, N.M., Dall'Armi, C., Di Paolo, G., Brooks, S.V., Buj-Bello, A., Feldman, E.L., Dowling, J.J. (2016) PIK3C2B inhibition improves function and prolongs survival in myotubular myopathy animal models. The Journal of Clinical Investigation. 126(9):3613-25
- Dowling, J.J., Low, S.E., Busta, A.S., and Feldman, E.L. (2010) Zebrafish MTMR14 is required for excitation–contraction coupling, developmental motor function and the regulation of autophagy. Human molecular genetics. 19(13):2668-2681
- Dowling, J.J., Vreede, A.P., Low, S.E., Gibbs, E.M., Kuwada, J.Y., Bonnemann, C.G., and Feldman, E.L. (2009) Loss of myotubularin function results in T-tubule disorganization in zebrafish and human myotubular myopathy. PLoS Genetics. 5(2):e1000372
1 - 3 of 3
Show