Morpholino

MO3-mtm1

ID

ZDB-MRPHLNO-100325-3

Name

MO3-mtm1

Previous Names

Ex3 MO (1)

Target

mtm1 (1)

Sequence

5' - CCTGTCAACACACGCAGGAACATTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-mtm1

No data available

Phenotype

Phenotype resulting from MO3-mtm1

Phenotype	Fish	Figures
skeletal muscle cell decreased functionality, abnormal	WT + MO3-mtm1	text only from Dowling et al., 2009
skeletal muscle cell hypotrophic, abnormal	WT + MO3-mtm1	text only from Dowling et al., 2009
skeletal muscle cell morphology, abnormal	WT + MO3-mtm1	Fig. 4 from Dowling et al., 2010
skeletal muscle cell perinuclear region of cytoplasm disorganized, abnormal	WT + MO3-mtm1	Fig. 5 from Dowling et al., 2010
skeletal muscle cell sarcoplasmic reticulum morphology, abnormal	WT + MO3-mtm1	Fig. 5 from Dowling et al., 2010
skeletal muscle cell T-tubule disorganized, abnormal	WT + MO3-mtm1	text only from Dowling et al., 2009
skeletal muscle cell T-tubule morphology, abnormal	WT + MO3-mtm1	Fig. 5 from Dowling et al., 2010
ventral fin fold absent, abnormal	AB + MO3-mtm1	Fig. S9 from Sabha et al., 2016
ventral fin fold degenerate, abnormal	AB + MO3-mtm1	Fig. S9 from Sabha et al., 2016
whole organism decreased length, abnormal	WT + MO3-mtm1	Fig. 3 from Dowling et al., 2010
whole organism morphology, abnormal	WT + MO3-mtm1	Fig. 3 from Dowling et al., 2010

Phenotype of all Fish created by or utilizing MO3-mtm1

Phenotype	Fish	Conditions	Figures
ventral fin fold degenerate, abnormal	AB + MO3-mtm1	standard conditions	Fig. S9 from Sabha et al., 2016
ventral fin fold absent, abnormal	AB + MO3-mtm1	standard conditions	Fig. S9 from Sabha et al., 2016
skeletal muscle cell sarcoplasmic reticulum morphology, abnormal	WT + MO3-mtm1	standard conditions	Fig. 5 from Dowling et al., 2010
skeletal muscle cell T-tubule morphology, abnormal	WT + MO3-mtm1	standard conditions	Fig. 5 from Dowling et al., 2010
skeletal muscle cell perinuclear region of cytoplasm disorganized, abnormal	WT + MO3-mtm1	standard conditions	Fig. 5 from Dowling et al., 2010
whole organism morphology, abnormal	WT + MO3-mtm1	standard conditions	Fig. 3 from Dowling et al., 2010
skeletal muscle cell hypotrophic, abnormal	WT + MO3-mtm1	standard conditions	text only from Dowling et al., 2009
skeletal muscle cell T-tubule disorganized, abnormal	WT + MO3-mtm1	standard conditions	text only from Dowling et al., 2009
skeletal muscle cell morphology, abnormal	WT + MO3-mtm1	standard conditions	Fig. 4 from Dowling et al., 2010
whole organism decreased length, abnormal	WT + MO3-mtm1	standard conditions	Fig. 3 from Dowling et al., 2010
skeletal muscle cell decreased functionality, abnormal	WT + MO3-mtm1	standard conditions	text only from Dowling et al., 2009
skeletal muscle cell nucleus irregular spatial pattern, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 7 from Dowling et al., 2010
skeletal muscle cell vacuole morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
autophagy increased occurrence, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 9 from Dowling et al., 2010
head hypoplastic, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
skeletal muscle cell morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 7 from Dowling et al., 2010
extension aplastic, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
whole organism morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
skeletal muscle cell sarcoplasm disorganized, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
whole organism edematous, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
post-vent region bent, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
trunk hypoplastic, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
skeletal muscle cell mitochondrion morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
skeletal muscle cell endoplasmic reticulum decreased mass density, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
whole organism decreased length, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
whole organism decreased size, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010

Citations