Morpholino
MO1-rpgrip1l
- ID
- ZDB-MRPHLNO-100324-2
- Name
- MO1-rpgrip1l
- Previous Names
- None
- Target
- Sequence
-
5' - TCTGTCAGTGCAGATTGAGTCACTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rpgrip1l
No data available
Phenotype
Phenotype resulting from MO1-rpgrip1l
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-rpgrip1l
1 - 5 of 8 Show all
Citations
- Wang, H., Zaiser, F., Eckert, P., Ruf, J., Kayser, N., Veenstra, A.C., Müller, M., Haas, R., Walz, G., Yakulov, T.A. (2023) Inversin (NPHP2) and Vangl2 are required for normal zebrafish cloaca formation. Biochemical and Biophysical Research Communications. 673:9159-15
- Kayser, N., Zaiser, F., Veenstra, A.C., Wang, H., Göcmen, B., Eckert, P., Franz, H., Köttgen, A., Walz, G., Yakulov, T.A. (2022) Clock genes rescue nphp mutations in zebrafish. Human molecular genetics. 31(24):4143-4158
- Khanna, H., Davis, E.E., Murga-Zamalloa, C.A., Estrada-Cuzcano, A., Lopez, I., den Hollander, A.I., Zonneveld, M.N., Othman, M.I., Waseem, N., Chakarova, C.F., Maubaret, C., Diaz-Font, A., Macdonald, I., Muzny, D.M., Wheeler, D.A., Morgan, M., Lewis, L.R., Logan, C.V., Tan, P.L., Beer, M.A., Inglehearn, C.F., Lewis, R.A., Jacobson, S.G., Bergmann, C., Beales, P.L., Attié-Bitach, T., Johnson, C.A., Otto, E.A., Bhattacharya, S.S., Hildebrandt, F., Gibbs, R.A., Koenekoop, R.K., Swaroop, A., and Katsanis, N. (2009) A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies. Nature Genetics. 41(6):739-745
1 - 3 of 3
Show