Morpholino

MO2-gnptab

ID
ZDB-MRPHLNO-100302-2
Name
MO2-gnptab
Previous Names
None
Target
Sequence
5' - AAACATTTGTAGAGCCAACCTGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gnptab
No data available
Phenotype
Phenotype resulting from MO2-gnptab
Phenotype Fish Figures
branchiostegal ray disorganized, abnormal y1Tg + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
branchiostegal ray chondrocyte spheroid, abnormal y1Tg + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
cardiac chamber morphogenesis decreased process quality, abnormal f1Tg/f1Tg + MO2-gnptab Figure 2 with image from Lu et al., 2020
cardiac jelly spp1 expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab Figure 3 with image from Lu et al., 2020
cardiac jelly acana expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab Figure 3 with image from Lu et al., 2020
cardiac jelly acana expression spatial pattern, abnormal f1Tg/f1Tg + MO2-gnptab Figure 3 with image from Lu et al., 2020
cardiac jelly spp1 expression spatial pattern, abnormal f1Tg/f1Tg + MO2-gnptab Figure 3 with image from Lu et al., 2020
cardiac muscle cell EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab Figure 5 with image from Lu et al., 2020
cardiac muscle cell EGFP expression spatial pattern, abnormal f1Tg/f1Tg + MO2-gnptab Figure 2 with image from Lu et al., 2020
cardiac muscle cell RFP expression spatial pattern, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus ab1-smad labeling decreased amount, abnormal f1Tg/f1Tg + MO2-gnptab Figure 3 with imageFigure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling increased amount, abnormal f1Tg/f1Tg + MO2-gnptab Figure 3 with imageFigure 5 with image from Lu et al., 2020
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
ceratohyal cartilage malformed, abnormal WT + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
chondrocyte intercalation involved in growth plate cartilage morphogenesis disrupted, abnormal y1Tg + MO2-gnptab Fig. 5 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte hyperplastic, abnormal WT + MO2-gnptab Fig. 6 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte increased size, abnormal y1Tg + MO2-gnptab Fig. 5 from Flanagan-Steet et al., 2009
cranial cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab Fig. 4 from Flanagan-Steet et al., 2009
cysteine-type peptidase activity decreased process quality, abnormal WT + MO2-gnptab Fig. 4 with image from Qian et al., 2013
endocardium notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab Figure 2 with image from Lu et al., 2020
heart BMP signaling pathway decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab Figure 3 with imageFigure 5 with image from Lu et al., 2020
heart looping decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab Figure 3 with image from Lu et al., 2020
heart valve malformed, abnormal f1Tg/f1Tg + MO2-gnptab Figure 2 with image from Lu et al., 2020
heart valve cell notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab Figure 2 with image from Lu et al., 2020
heart valve endothelial cell EGFP expression spatial pattern, abnormal s849Tg/s849Tg + MO2-gnptab Figure 5 with image from Lu et al., 2020
inner ear morphology, abnormal WT + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
mandibular arch skeleton decreased length, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
mandibular arch skeleton flattened, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
mandibular arch skeleton morphology, abnormal WT + MO2-gnptab Fig. 4 with image from Qian et al., 2013
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
Meckel's cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab Fig. 9 with image from Petrey et al., 2012
neurocranial trabecula collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab Fig. 9 with image from Petrey et al., 2012
neurocranium blunt, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
otolith decreased size, abnormal WT + MO2-gnptab Fig. 7 from Flanagan-Steet et al., 2009
otolith mineralization disrupted, abnormal WT + MO2-gnptab Fig. 7 from Flanagan-Steet et al., 2009
palatoquadrate cartilage decreased length, abnormal WT + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
peptidyl-serine phosphorylation increased occurrence, abnormal WT + MO2-gnptab Fig. 8 from Flanagan-Steet et al., 2009
pericardium edematous, abnormal s849Tg/s849Tg + MO2-gnptab Figure 2 with imageFigure 3 with image from Lu et al., 2020
Fig. 1Fig. 7 from Flanagan-Steet et al., 2009
regulation of heart contraction decreased process quality, abnormal s849Tg/s849Tg + MO2-gnptab Figure 5 with image from Lu et al., 2020
ventral mandibular arch malformed, abnormal WT + MO2-gnptab Fig. 7 from Flanagan-Steet et al., 2009
ventral mandibular arch retracted, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
yolk increased size, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
Phenotype of all Fish created by or utilizing MO2-gnptab
Phenotype Fish Conditions Figures
cardiac muscle cell nucleus ab1-smad labeling decreased amount, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
cardiac chamber morphogenesis decreased process quality, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac jelly spp1 expression spatial pattern, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
heart valve malformed, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac muscle cell EGFP expression spatial pattern, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac jelly acana expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
endocardium notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac jelly spp1 expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling increased amount, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
pericardium edematous, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 2 with image from Lu et al., 2020
heart valve cell notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac jelly acana expression spatial pattern, abnormal f1Tg/f1Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
heart valve endothelial cell EGFP expression spatial pattern, abnormal s849Tg/s849Tg + MO2-gnptab standard conditions Figure 5 with image from Lu et al., 2020
regulation of heart contraction process quality, ameliorated s849Tg/s849Tg + MO2-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
regulation of heart contraction decreased process quality, abnormal s849Tg/s849Tg + MO2-gnptab standard conditions Figure 5 with image from Lu et al., 2020
pericardium edematous, abnormal s849Tg/s849Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
pericardium edematous, ameliorated s849Tg/s849Tg + MO2-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
heart valve endothelial cell EGFP expression spatial pattern, ameliorated s849Tg/s849Tg + MO2-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling amount, ameliorated AB + MO2-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus ab1-smad labeling decreased amount, abnormal AB + MO2-gnptab standard conditions Figure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus ab1-smad labeling amount, ameliorated AB + MO2-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling increased amount, abnormal AB + MO2-gnptab standard conditions Figure 5 with image from Lu et al., 2020
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
peptidyl-serine phosphorylation increased occurrence, abnormal WT + MO2-gnptab standard conditions Fig. 8 from Flanagan-Steet et al., 2009
otolith decreased size, abnormal WT + MO2-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
cysteine-type peptidase activity decreased process quality, abnormal WT + MO2-gnptab standard conditions Fig. 4 with image from Qian et al., 2013
palatoquadrate cartilage decreased length, abnormal WT + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
ventral mandibular arch malformed, abnormal WT + MO2-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
mandibular arch skeleton decreased length, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
mandibular arch skeleton flattened, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
cranial cartilage chondrocyte hyperplastic, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Flanagan-Steet et al., 2009
mandibular arch skeleton morphology, abnormal WT + MO2-gnptab standard conditions Fig. 4 with image from Qian et al., 2013
otolith mineralization disrupted, abnormal WT + MO2-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
yolk increased size, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
ceratohyal cartilage malformed, abnormal WT + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
ventral mandibular arch retracted, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
neurocranium blunt, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
inner ear morphology, abnormal WT + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
pericardium edematous, abnormal WT + MO2-gnptab standard conditions Fig. 1Fig. 7 from Flanagan-Steet et al., 2009
chondrocyte intercalation involved in growth plate cartilage morphogenesis disrupted, abnormal y1Tg + MO2-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2009
branchiostegal ray disorganized, abnormal y1Tg + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
cranial cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2009
branchiostegal ray chondrocyte spheroid, abnormal y1Tg + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
Meckel's cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab standard conditions Fig. 9 with image from Petrey et al., 2012
neurocranial trabecula collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab standard conditions Fig. 9 with image from Petrey et al., 2012
cranial cartilage chondrocyte increased size, abnormal y1Tg + MO2-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2009
cardiac muscle cell EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab standard conditions Figure 5 with image from Lu et al., 2020
heart BMP signaling pathway process quality, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell RFP expression spatial pattern, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
heart BMP signaling pathway process quality, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
cardiac muscle cell RFP expression spatial pattern, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
cardiac muscle cell EGFP expression amount, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
heart looping process quality, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
cardiac muscle cell EGFP expression amount, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
heart looping decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab standard conditions Figure 3 with image from Lu et al., 2020
heart BMP signaling pathway decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO2-gnptab standard conditions Figure 3 with imageFigure 5 with image from Lu et al., 2020
Citations