Morpholino

MO1-alg13

ID

ZDB-MRPHLNO-100225-13

Name

MO1-alg13

Previous Names

Target

Sequence

5' - GGCTTTTTGCATCCTCAAGAAATGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-alg13

Expressed Gene	Anatomy	Figures
bmp4	whole organism ventral margin	Fig. 3 from Tse et al., 2009
chrd	whole organism dorsal region	Fig. 3 from Tse et al., 2009
elavl3	neuron	Fig. 2 from Tse et al., 2009
eve1	whole organism ventral margin	Fig. 3 from Tse et al., 2009
gata1a	hematopoietic multipotent progenitor cell	Fig. 4 from Tse et al., 2009
gata2a	whole organism ventral margin	Fig. 3 from Tse et al., 2009
gsc	whole organism dorsal region	Fig. 3 from Tse et al., 2009
myod1	somite muscle	Fig. 4 from Tse et al., 2009
pax2a	midbrain otic placode pronephros	Fig. 4 from Tse et al., 2009

Phenotype

Phenotype resulting from MO1-alg13

Phenotype	Fish	Figures
central nervous system necrotic, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009
eye decreased size, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009
notochord malformed, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009
pigmentation decreased occurrence, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009
post-vent region curled, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009
trunk immature, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal	AB + MO1-alg13	Fig. S4 from Tse et al., 2009

Phenotype of all Fish created by or utilizing MO1-alg13

Phenotype	Fish	Conditions	Figures
post-vent region curled, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009
eye decreased size, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009
trunk immature, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009
notochord malformed, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009
pigmentation decreased occurrence, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal	AB + MO1-alg13	standard conditions	Fig. S4 from Tse et al., 2009

Citations