Morpholino

MO3-tcap

ID

ZDB-MRPHLNO-100218-1

Name

MO3-tcap

Previous Names

None

Target

tcap (1)

Sequence

5' - TCTCCAGGACTGAGCAAACCTGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to translation-start site

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-tcap

Expressed Gene	Anatomy	Figures
dmd	vertical myoseptum	Fig. 4 from Zhang et al., 2009
myod1	somite myoblast	Fig. S3 from Zhang et al., 2009

Phenotype

Phenotype resulting from MO3-tcap

Phenotype	Fish	Figures
heart edematous, abnormal	WT + MO3-tcap	Fig. 3 from Zhang et al., 2009
muscle disorganized, abnormal	WT + MO3-tcap	Fig. 3 from Zhang et al., 2009
myotome malformed, abnormal	WT + MO3-tcap	Fig. 4, Fig. 5 from Zhang et al., 2009
myotome T-tubule decreased amount, abnormal	WT + MO3-tcap	Fig. 6 from Zhang et al., 2009
myotome T-tubule mislocalised, abnormal	WT + MO3-tcap	Fig. 6 from Zhang et al., 2009
post-vent region curved, abnormal	WT + MO3-tcap	Fig. 3 from Zhang et al., 2009
sensory perception of touch process quality, abnormal	WT + MO3-tcap	Fig. 3 from Zhang et al., 2009
skeletal muscle cell myofibril disorganized, abnormal	WT + MO3-tcap	Fig. 4, Fig. 5, Fig. 6 from Zhang et al., 2009
skeletal muscle cell myofibril disoriented, abnormal	WT + MO3-tcap	Fig. 5 from Zhang et al., 2009
skeletal muscle cell myofibril increased variability of size, abnormal	WT + MO3-tcap	Fig. 5 from Zhang et al., 2009
skeletal muscle cell myofibril undulate, abnormal	WT + MO3-tcap	Fig. 5 from Zhang et al., 2009
T-tubule organization process quality, abnormal	WT + MO3-tcap	Fig. 6 from Zhang et al., 2009
vertical myoseptum malformed, abnormal	WT + MO3-tcap	Fig. 4 from Zhang et al., 2009
voluntary musculoskeletal movement arrested, abnormal	WT + MO3-tcap	Fig. 3 from Zhang et al., 2009
whole organism decreased length, abnormal	WT + MO3-tcap	Fig. 3 from Zhang et al., 2009

Phenotype of all Fish created by or utilizing MO3-tcap

Phenotype	Fish	Conditions	Figures
skeletal muscle cell myofibril undulate, abnormal	WT + MO3-tcap	standard conditions	Fig. 5 from Zhang et al., 2009
whole organism decreased length, abnormal	WT + MO3-tcap	standard conditions	Fig. 3 from Zhang et al., 2009
myotome T-tubule decreased amount, abnormal	WT + MO3-tcap	standard conditions	Fig. 6 from Zhang et al., 2009
muscle disorganized, abnormal	WT + MO3-tcap	standard conditions	Fig. 3 from Zhang et al., 2009
post-vent region curved, abnormal	WT + MO3-tcap	standard conditions	Fig. 3 from Zhang et al., 2009
voluntary musculoskeletal movement arrested, abnormal	WT + MO3-tcap	standard conditions	Fig. 3 from Zhang et al., 2009
skeletal muscle cell myofibril increased variability of size, abnormal	WT + MO3-tcap	standard conditions	Fig. 5 from Zhang et al., 2009
myotome T-tubule mislocalised, abnormal	WT + MO3-tcap	standard conditions	Fig. 6 from Zhang et al., 2009
skeletal muscle cell myofibril disorganized, abnormal	WT + MO3-tcap	standard conditions	Fig. 4, Fig. 5, Fig. 6 from Zhang et al., 2009
vertical myoseptum malformed, abnormal	WT + MO3-tcap	standard conditions	Fig. 4 from Zhang et al., 2009
heart edematous, abnormal	WT + MO3-tcap	standard conditions	Fig. 3 from Zhang et al., 2009
T-tubule organization process quality, abnormal	WT + MO3-tcap	standard conditions	Fig. 6 from Zhang et al., 2009
sensory perception of touch process quality, abnormal	WT + MO3-tcap	standard conditions	Fig. 3 from Zhang et al., 2009
skeletal muscle cell myofibril disoriented, abnormal	WT + MO3-tcap	standard conditions	Fig. 5 from Zhang et al., 2009
myotome malformed, abnormal	WT + MO3-tcap	standard conditions	Fig. 4, Fig. 5 from Zhang et al., 2009

Citations