Morpholino

MO1-usp15

ID
ZDB-MRPHLNO-100217-8
Name
MO1-usp15
Previous Names
None
Target
Sequence
5' - CATCTTCTGTCCTCAGATCAGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: KN150487.1
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-usp15
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image from Tse et al., 2009
chrd Fig. 3 with image from Tse et al., 2009
elavl3 Fig. 2 with image from Tse et al., 2009
eve1 Fig. 3 with image from Tse et al., 2009
gata1a Fig. 4 with image from Tse et al., 2009
gata2a Fig. 3 with image from Tse et al., 2009
gsc Fig. 3 with image from Tse et al., 2009
myod1 Fig. 4 with image from Tse et al., 2009
pax2a Fig. 4 with image from Tse et al., 2009
Phenotype
Phenotype resulting from MO1-usp15
Phenotype Fish Figures
central nervous system necrotic, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
ethmoid cartilage shape, abnormal AB + MO1-usp15 Fig. 3 from Tse, 2017
eye decreased size, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
eye malformed, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
gut immature, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
head decreased size, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
head malformed, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
liver immature, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal AB + MO1-usp15 Fig. 3 from Tse, 2017
Meckel's cartilage morphology, abnormal AB + MO1-usp15 Fig. 3 from Tse, 2017
notochord development disrupted, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal AB + MO1-usp15 Fig. 3 from Tse, 2017
post-vent region curled, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
post-vent region necrotic, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
trunk edematous, abnormal AB + MO1-usp15 Fig. S4 from Tse et al., 2009
Phenotype of all Fish created by or utilizing MO1-usp15
Phenotype Fish Conditions Figures
mandibular arch skeleton decreased size, abnormal AB + MO1-usp15 standard conditions Fig. 3 from Tse, 2017
ethmoid cartilage shape, abnormal AB + MO1-usp15 standard conditions Fig. 3 from Tse, 2017
pharyngeal arch cartilage malformed, abnormal AB + MO1-usp15 standard conditions Fig. 3 from Tse, 2017
post-vent region curled, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
head malformed, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
post-vent region necrotic, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
eye malformed, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
notochord development disrupted, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
liver immature, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
head decreased size, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
Meckel's cartilage morphology, abnormal AB + MO1-usp15 standard conditions Fig. 3 from Tse, 2017
trunk edematous, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
gut immature, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
eye decreased size, abnormal AB + MO1-usp15 standard conditions Fig. S4 from Tse et al., 2009
Citations
TSV
1 - 3 of 3
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.